ID: 1045653424

View in Genome Browser
Species Human (GRCh38)
Location 8:104364010-104364032
Sequence TCAGGGGATGAGCTCCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 5, 1: 19, 2: 29, 3: 53, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045653424_1045653437 28 Left 1045653424 8:104364010-104364032 CCCAGAGGGAGCTCATCCCCTGA 0: 5
1: 19
2: 29
3: 53
4: 183
Right 1045653437 8:104364061-104364083 CGTCCACCTGGAACCCACGCTGG No data
1045653424_1045653432 16 Left 1045653424 8:104364010-104364032 CCCAGAGGGAGCTCATCCCCTGA 0: 5
1: 19
2: 29
3: 53
4: 183
Right 1045653432 8:104364049-104364071 TTGCGGAACCCCCGTCCACCTGG No data
1045653424_1045653427 -8 Left 1045653424 8:104364010-104364032 CCCAGAGGGAGCTCATCCCCTGA 0: 5
1: 19
2: 29
3: 53
4: 183
Right 1045653427 8:104364025-104364047 TCCCCTGATCAAGCACAGCAGGG No data
1045653424_1045653431 -1 Left 1045653424 8:104364010-104364032 CCCAGAGGGAGCTCATCCCCTGA 0: 5
1: 19
2: 29
3: 53
4: 183
Right 1045653431 8:104364032-104364054 ATCAAGCACAGCAGGGCTTGCGG No data
1045653424_1045653426 -9 Left 1045653424 8:104364010-104364032 CCCAGAGGGAGCTCATCCCCTGA 0: 5
1: 19
2: 29
3: 53
4: 183
Right 1045653426 8:104364024-104364046 ATCCCCTGATCAAGCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045653424 Original CRISPR TCAGGGGATGAGCTCCCTCT GGG (reversed) Intronic
900503086 1:3016223-3016245 CCAGGGGATGAGCCCCACCTAGG - Intergenic
900748049 1:4374662-4374684 GCTGGGCATGAGCTCCCTCATGG + Intergenic
900974893 1:6010836-6010858 TCTGGGGAAGAGCGCCCTCATGG - Intronic
901673564 1:10869678-10869700 TGGGGGGGTGAGGTCCCTCTAGG - Intergenic
902205152 1:14863109-14863131 TCAGGTGGTGAGCTTGCTCTGGG + Intronic
902310781 1:15579973-15579995 TCAGGTTATGAGCTGCTTCTGGG - Intronic
902644524 1:17789229-17789251 TCAGGGGATCCCCTCGCTCTTGG - Intronic
903069738 1:20721257-20721279 GCTGGGGATGAGCCCCATCTAGG - Intronic
903144865 1:21364825-21364847 TCAGGGGAAAGGGTCCCTCTGGG - Intergenic
904263839 1:29306602-29306624 GCAGGGCTTGAGCTGCCTCTGGG + Intronic
905230959 1:36514690-36514712 GTAGGGGATGAGCTCCCTGCTGG + Intergenic
906475136 1:46164463-46164485 GCAGGAGATAAGCTCCCTGTGGG - Intronic
907779765 1:57555593-57555615 TCAGGTGCTGTGCTCACTCTGGG + Intronic
910468837 1:87529176-87529198 TCAGGAGATGAGTTCCCTCTGGG - Intergenic
910667255 1:89739064-89739086 TCAGGGGATGAGGTCACACCTGG - Intronic
912069872 1:105796031-105796053 TTTGGGGATGAGCTCCCTCTGGG + Intergenic
912927519 1:113926610-113926632 TCAGGGTATGACATCCTTCTAGG - Intergenic
914319594 1:146546387-146546409 TCTGGGGATCAGCTGGCTCTAGG + Intergenic
914322903 1:146582603-146582625 CCAAGGGAAAAGCTCCCTCTTGG - Intergenic
915098954 1:153484806-153484828 TCAGGGGAAGAGCTCCCCAAGGG - Intergenic
915317858 1:155039659-155039681 TATGGGGAGGAGCTCCCTCAGGG - Intronic
918696376 1:187551145-187551167 ATGGGGGACGAGCTCCCTCTGGG - Intergenic
919808655 1:201395931-201395953 TCAGCTGTTGAGCTCCCTCTGGG - Intronic
920887999 1:209951952-209951974 TCAGGGGATTAGGTACTTCTGGG + Intronic
922160588 1:223076916-223076938 GCTGGGTATGACCTCCCTCTTGG + Intergenic
923161389 1:231317582-231317604 CTTGGGGATGAGCTCCCTCTGGG + Intergenic
924085939 1:240451599-240451621 TCAGGGGATGAGGCCCCTGTTGG - Intronic
1062989182 10:1799661-1799683 TGAGGGGATGAGATCCTTCAGGG + Intergenic
1066411516 10:35174968-35174990 TCAAGGCATGAGCTTTCTCTGGG + Intronic
1069677620 10:70259969-70259991 GCAGGGGAAGGGCACCCTCTGGG - Intronic
1071456974 10:85858384-85858406 TGAGGGGGTGAGCTCCCAGTGGG - Intronic
1072381975 10:94882136-94882158 TCAGGGAAAGAACTCACTCTTGG + Intergenic
1072801360 10:98394424-98394446 TCAAGGGATGAGCACACCCTCGG - Intronic
1073598670 10:104824833-104824855 TCAGGGGCAGTGCTCCCTCTTGG - Intronic
1073872446 10:107880558-107880580 TCAGGGCATGAGTTCCCTTCTGG - Intergenic
1073970352 10:109040872-109040894 CTGGGGGATGAGCTCCCTCTGGG + Intergenic
1073971404 10:109048134-109048156 TCGGGAGATGAGCTCCCTCTGGG + Intergenic
1075145873 10:119882669-119882691 TCAGGGGCTCAGATCCCTCATGG - Intronic
1076386910 10:130063652-130063674 GCAGGGAATGTGCTCCCTCCAGG - Intergenic
1076907126 10:133368396-133368418 TCAGGGTCTCAGCTCCCTCCTGG + Intronic
1077167663 11:1151046-1151068 GCAGGGTCTCAGCTCCCTCTGGG + Intergenic
1079083203 11:17428225-17428247 CCAGGTGCTGAGCTCCCTCTGGG + Intronic
1087318857 11:96635929-96635951 TCGGGGGACAAGCTCCCTCTGGG + Intergenic
1087962239 11:104366449-104366471 TCAGGGGATGAGCTCCCGCTGGG - Intergenic
1088399933 11:109412390-109412412 TCAGGGAATTAGCTCCTCCTTGG + Intergenic
1089834592 11:121358818-121358840 TTAGTAGATGAGCTCCATCTTGG - Intergenic
1090177318 11:124662659-124662681 CCAGAGGATGCACTCCCTCTAGG + Intronic
1094526490 12:31234485-31234507 TCTGGGGAAGAGCACCATCTGGG + Intergenic
1095709124 12:45269402-45269424 TAAGGGCATAAGCTACCTCTGGG - Intronic
1099437253 12:82659455-82659477 ATCAGGGATGAGCTCCCTCTGGG - Intergenic
1100612556 12:96203400-96203422 TCAGTCTGTGAGCTCCCTCTGGG + Intronic
1103832164 12:123788579-123788601 ACAGGGCATCACCTCCCTCTCGG - Intronic
1104585221 12:130042716-130042738 TCAGCCGAGGAGCTCCCGCTGGG + Intergenic
1105806152 13:23952840-23952862 TCGGGGGATGAGCTCCCTCTGGG - Intergenic
1106163370 13:27219884-27219906 TTGGGGTATGAGCTCCCTCTGGG + Intergenic
1106768986 13:32943814-32943836 TCAGGGCAAGAGCTTCCTATGGG + Intergenic
1108817805 13:54313198-54313220 TCAGGGAATGAGCTTGCTCTGGG + Intergenic
1108818499 13:54318009-54318031 TTGGGGGATGAGCTCCCTCTGGG + Intergenic
1108855482 13:54787878-54787900 CTGGGGGATGAGCTCCCTCTGGG - Intergenic
1109534087 13:63693783-63693805 TTGGGGGACAAGCTCCCTCTGGG - Intergenic
1110597218 13:77332316-77332338 TCAGGTGATCCGCCCCCTCTTGG + Intergenic
1110715081 13:78693066-78693088 TTAGGGCATGGTCTCCCTCTGGG + Intergenic
1111096067 13:83517055-83517077 TGGGGGGACGATCTCCCTCTGGG + Intergenic
1111103254 13:83613634-83613656 TCAGGGGACGAGTTCCCTCTGGG - Intergenic
1111232609 13:85363284-85363306 TTAGGGGACCAGCTCCCTCTGGG + Intergenic
1114566355 14:23635889-23635911 CTGGGGGATGAGCTCCCTCTGGG + Intronic
1115284910 14:31705833-31705855 TCGGGGGATGTGCTCCTTCTGGG - Intronic
1115285879 14:31712372-31712394 TCAGGGGACGAACTCCCTCTGGG - Intronic
1117291424 14:54337516-54337538 TCAGGAGCTCAGCTCCCTCGTGG - Intergenic
1119636746 14:76279443-76279465 TCTGGGGTGAAGCTCCCTCTTGG + Intergenic
1120030123 14:79631562-79631584 AAAAGGGACGAGCTCCCTCTGGG + Intronic
1120418693 14:84254596-84254618 CCAGGGGATTAGCTGCCCCTGGG + Intergenic
1121655001 14:95588542-95588564 CCAGGTGGTGAGCTCCGTCTGGG + Intergenic
1121703042 14:95970610-95970632 TCTGGAGATTAGCTCCCTCTGGG + Intergenic
1122081657 14:99271159-99271181 ACGGGTGATGAGCTCCCTCTGGG + Exonic
1123827616 15:24099424-24099446 CAAGGGGAGGAGCTCCCTGTTGG + Intergenic
1123842074 15:24258806-24258828 CAAGGGGAGGAGCTCCCTGTTGG + Intergenic
1123857092 15:24424883-24424905 CAAGGGGAGGAGCTCCCTGTTGG + Intergenic
1124072547 15:26409484-26409506 TCAGGTGATCCGCCCCCTCTTGG - Intergenic
1126191816 15:45886091-45886113 TAGGGGTAGGAGCTCCCTCTGGG + Intergenic
1130162366 15:81414161-81414183 TCTGGGGACGAGCTCCCTCTGGG + Intergenic
1130652505 15:85770034-85770056 TCAGGGTATGAGCCAGCTCTGGG + Intronic
1130980029 15:88805973-88805995 TCAGGAGGTGAGCTCTCTCTTGG - Intronic
1132081884 15:98873086-98873108 TCAGGGGATGTGCACCCTGAAGG + Intronic
1132366431 15:101261082-101261104 TCAGGGTCAGAGCTCCCTGTGGG - Intergenic
1135338955 16:21630214-21630236 TCGGGGGACAAGCTCCCACTGGG - Intronic
1135340047 16:21637601-21637623 TCAGGGGACAAGCTCCCTCTGGG - Intronic
1138421728 16:56903414-56903436 CCAGGGGGTAAGCTCCCTCGTGG - Intronic
1138780009 16:59772382-59772404 TCAGTGCATCAGCTCACTCTTGG - Intergenic
1140010657 16:71128247-71128269 CCAAGGGAAAAGCTCCCTCTTGG + Intronic
1140013930 16:71163694-71163716 TCTGGGGATCAGCTGGCTCTAGG - Intronic
1141940508 16:87273078-87273100 TCAGGGAATGGGCTTCCTTTTGG - Intronic
1144678402 17:17176467-17176489 ACAGGAGATTAGCTCCCTCAAGG + Exonic
1145220636 17:21085752-21085774 TCGGGGGACAAGCTCCCTCTGGG - Intergenic
1146253428 17:31371966-31371988 ACTTGGGATGACCTCCCTCTAGG - Intronic
1147335524 17:39725045-39725067 CCAGGGGATGAGCTACCTGGAGG + Exonic
1148495444 17:48050961-48050983 ACAAGGGATGAGCTCCCTGACGG - Exonic
1148898104 17:50852271-50852293 TCAGGCTAGAAGCTCCCTCTAGG - Intergenic
1151726923 17:75890804-75890826 CCAGGGGCTGTGTTCCCTCTGGG - Exonic
1152581740 17:81168365-81168387 ACAGGGGAGGAGCTGCCCCTGGG + Intergenic
1152891396 17:82883601-82883623 TCAGGGCCTCAGGTCCCTCTGGG + Intronic
1154025054 18:10699098-10699120 TCAGATGATGAGCTCTCCCTCGG - Exonic
1155327097 18:24675572-24675594 CCAGGGGGGCAGCTCCCTCTGGG - Intergenic
1156118934 18:33820164-33820186 ATGGGGGACGAGCTCCCTCTGGG - Intergenic
1156324758 18:36064310-36064332 ATGGGGGACGAGCTCCCTCTGGG + Intronic
1157801952 18:50627995-50628017 TCAGGGAATAAGCTCCCACCAGG + Intronic
1159346705 18:67215760-67215782 TGGGGGGACCAGCTCCCTCTGGG - Intergenic
1159498789 18:69241350-69241372 TCAGGAGATGATCCCTCTCTAGG - Intergenic
1160548983 18:79681037-79681059 GCCGGGCGTGAGCTCCCTCTGGG + Intronic
1162309533 19:9897624-9897646 TCAGGGGCTGAGCTCCCTCCCGG + Intronic
1163066231 19:14798132-14798154 TCAGGTGATGTTCTCCCTCTAGG - Intronic
1163822370 19:19503222-19503244 TAAGGAGATGGGCACCCTCTGGG + Intronic
1164438522 19:28253239-28253261 ATAGAGGATGAGCTCCCTGTTGG - Intergenic
1164562049 19:29299286-29299308 TCTGGAGATGAGCTGCCCCTGGG - Intergenic
1165606967 19:37114065-37114087 CTAGGGGAGGCGCTCCCTCTTGG + Intronic
1166356395 19:42230009-42230031 TGTGGTGATGAGCTCCATCTGGG - Intergenic
1166375111 19:42323667-42323689 TCAGCGGATTGGCTCCCTCCGGG - Exonic
925010319 2:480001-480023 TCAGGCAATGCGCTCCATCTGGG + Intergenic
926083348 2:10006316-10006338 GTCGGGGACGAGCTCCCTCTGGG - Intergenic
926205776 2:10833514-10833536 TCAGGGAATGAGCCCGCTGTGGG - Intronic
926446116 2:12945200-12945222 TCAGGGAATGTATTCCCTCTAGG - Intergenic
927121786 2:19971343-19971365 TCAGGGCATGAGGGCCCTCATGG + Intronic
927164797 2:20306978-20307000 TCAGGTGATCAGCCCCCCCTCGG - Intronic
928152354 2:28843313-28843335 TCAGGTGATCCGCCCCCTCTTGG - Intronic
928793864 2:34992172-34992194 TCAGGGGAGGAACTCCCTCTGGG + Intergenic
928914890 2:36460004-36460026 TAAGGGGGTGAGTGCCCTCTAGG + Intronic
930585172 2:53259733-53259755 TCAGGGGACCAGCTCCCTCTGGG - Intergenic
933797203 2:85929162-85929184 TCAGGGGATGAGCTCCCTCTGGG - Intergenic
934659908 2:96137895-96137917 TCAGGGAAGGAGCTCCCTTAGGG + Intronic
937880007 2:126857819-126857841 TCAGGGGATGGGCCACCTGTTGG - Intergenic
938153140 2:128903757-128903779 TCAGGTGATGAGCTCCCTCTGGG - Intergenic
938177185 2:129144481-129144503 TCCGGGGATGAGCTCCCTCTGGG - Intergenic
938692003 2:133800361-133800383 TTAGCAGATGAGGTCCCTCTTGG - Intergenic
941245136 2:163086795-163086817 ATAGGATATGAGCTCCCTCTGGG - Intergenic
941616654 2:167728151-167728173 TCAGGTGATCCGCTCCCCCTTGG - Intergenic
942577555 2:177380403-177380425 TCATAGGATGAGCTCCCTCGAGG - Intronic
942903010 2:181145706-181145728 TCGTGGGAGGAGCTCCCTCTGGG - Intergenic
944237135 2:197450828-197450850 TCCAGGGACGAGCTCCCTCTGGG + Intergenic
944688214 2:202136588-202136610 TCGGGGGATGAGCTCCCTCTGGG - Intronic
946160551 2:217833231-217833253 ACAGGGCAGGAGCTCTCTCTTGG + Intronic
947636529 2:231683292-231683314 TCAGGGGCTGCCTTCCCTCTGGG + Intergenic
949053843 2:241913784-241913806 TCAGGGGAGGAGCCCCTTCCGGG + Intergenic
1170589379 20:17760009-17760031 TCACTGGATGAAGTCCCTCTGGG + Intergenic
1173799339 20:45885165-45885187 ACAGGGGAAGAGGCCCCTCTGGG + Exonic
1176284684 21:5013181-5013203 TCAGCGGATGGGTCCCCTCTGGG + Intergenic
1177580965 21:23021569-23021591 TCGGGGGATGAGCTCCCTCTGGG - Intergenic
1177715968 21:24840321-24840343 TTGGGGGACGAGCTCCCTCTGGG - Intergenic
1179590283 21:42403585-42403607 TCAGGGAATGAGTTCCCTCCTGG - Intergenic
1179872497 21:44250294-44250316 TCAGCGGATGGGTCCCCTCTGGG - Intronic
1183663306 22:39233936-39233958 TCAGGGCATGCGGTCCCCCTGGG - Intronic
1183964779 22:41435098-41435120 TCAGGTGAGCAGCTCCCTCTGGG + Exonic
1184073316 22:42160501-42160523 TCAAGGGATGACCCTCCTCTGGG - Exonic
949133603 3:536011-536033 TCGGGGGATGAGCTCCCTGTGGG - Intergenic
950583290 3:13876990-13877012 TGAGAGGATGAGCTCCCTGAGGG + Intronic
953626716 3:44578262-44578284 ACAGGAGATTAGCTCCCTCAAGG - Intronic
957271008 3:78030054-78030076 TCGGGGGACGAGCACCCTCTGGG + Intergenic
957919862 3:86733293-86733315 TCAGGGGAGGAGCTCCCTCTGGG - Intergenic
960573239 3:119205796-119205818 ACAGGGAAGGAGCTTCCTCTGGG + Intergenic
962106627 3:132396544-132396566 TCCAGGGATGAGCTCCCTCTGGG + Intergenic
964130538 3:153281528-153281550 TTGGGGTATGAGCTCCCTCTGGG + Intergenic
965139250 3:164814372-164814394 TTGGCGGATGAGCTCCCTCTGGG + Intergenic
965139862 3:164818598-164818620 TCAGGGGACGAGCTCCCTCTGGG + Intergenic
965482275 3:169233335-169233357 TCTGGGGATGAACTACTTCTTGG + Intronic
969356887 4:6633213-6633235 CCAGGGGCTGTGCTGCCTCTGGG + Intergenic
969781766 4:9409847-9409869 CCAGGGGATGAGCTCTCTCTAGG - Intergenic
972784627 4:42315298-42315320 TCTGGGGACGAGCTCCCTCTGGG - Intergenic
972790859 4:42369763-42369785 TCAGGGGACGAGCTCTCTCTGGG + Intergenic
972838886 4:42908035-42908057 TCAGGAGATGACCCCCCTGTAGG - Intronic
975033901 4:69658173-69658195 TCAGGGAACGAGCTCCCTCTGGG - Intergenic
975200411 4:71581612-71581634 TGAGGGAATGAGCTACCTCTGGG - Intergenic
976596994 4:86904148-86904170 TCTCGGGATGAGCTCCTTCTGGG - Intronic
977370281 4:96126321-96126343 TAGGGGGATGAGCTCCCTCTGGG - Intergenic
978915657 4:114123756-114123778 TCAGGGTATGGCCTCCCTCCTGG + Intergenic
978944742 4:114481942-114481964 CTGGGGGATGAGCTCCCTTTGGG - Intergenic
980158472 4:129133548-129133570 CCAGGGGAAGAGCGCCCTCAGGG + Intergenic
980234752 4:130090699-130090721 TCAGGAGACAAGCTCCCTGTGGG + Intergenic
980328455 4:131379481-131379503 TCAGGGGAGGAGCTCACTCTGGG + Intergenic
980809243 4:137853728-137853750 TCAGGGGAGGAGCTCCCTCTGGG + Intergenic
981170332 4:141615726-141615748 GTCTGGGATGAGCTCCCTCTGGG + Intergenic
982024347 4:151236355-151236377 TTGGGGGATGAGCTCCCTCTGGG + Intronic
982293824 4:153806465-153806487 GTCTGGGATGAGCTCCCTCTGGG + Intergenic
982630246 4:157822128-157822150 TCAGGGGAAGAGCTCCCTCTGGG + Intergenic
982700717 4:158657614-158657636 CAGGGGGACGAGCTCCCTCTGGG + Intergenic
982701778 4:158665067-158665089 TCGAGGAACGAGCTCCCTCTGGG + Intergenic
982773697 4:159421023-159421045 TCGGGGGATGAGCTCCCTCTGGG + Intergenic
983660647 4:170127839-170127861 TCTGGGGATGAGCTCCCTCTGGG - Intergenic
984095499 4:175428073-175428095 TCGGGGGACGCGCTCCCTGTCGG + Intergenic
985322971 4:188735144-188735166 TCAGGGGGCGAGCTCCCTCTGGG - Intergenic
985423538 4:189807110-189807132 TACGGGGACGAGCTCCCTCTGGG - Intergenic
985702194 5:1380401-1380423 TCTGGGGATGAGCTCCCTCTGGG - Intergenic
985795379 5:1958203-1958225 TCAGGGGCTGTGCACCCTCCTGG + Intergenic
987086114 5:14469694-14469716 TCAGGGTGTGTGCACCCTCTCGG + Intronic
987255905 5:16150620-16150642 TCAGAGGATGAGCTAGCTATAGG - Intronic
987445928 5:18020082-18020104 TCAGGGACTGAGCATCCTCTAGG + Intergenic
987923706 5:24314540-24314562 GTCTGGGATGAGCTCCCTCTGGG + Intergenic
988591396 5:32553007-32553029 TTAGGGGACAAGCTCCCTCTGGG - Intronic
989207148 5:38821991-38822013 TTGGGGGATGAGCTCCCTCTGGG + Intergenic
991120575 5:63008477-63008499 TGGGGGGACGAGCTCCCTCTGGG + Intergenic
991440676 5:66644983-66645005 TCAGTGGATGAGCTTCTTGTGGG + Intronic
994754612 5:103779012-103779034 TCCTGGGAGGAGCTCGCTCTGGG - Intergenic
995705979 5:114989812-114989834 TCGGGGGACGAGCTCTCTCTGGG + Intergenic
997329337 5:133047684-133047706 TGGGGGGATGAACTCCCTCTGGG + Intergenic
998787351 5:145727255-145727277 TCAGGGCATGAACCCCCTCATGG - Intronic
1004811820 6:19270899-19270921 TCAGGGGACAAACTCCCTCCAGG + Intergenic
1006221436 6:32495387-32495409 TTGAGGGATGAGCTCCCTCTGGG - Intergenic
1006733525 6:36254752-36254774 TCAGGGGCTGAGACCTCTCTGGG + Intronic
1007532379 6:42554316-42554338 CTGGGGGACGAGCTCCCTCTGGG + Intergenic
1008446552 6:51598493-51598515 TCAGGTGACGAGTTCCCTCTTGG + Intergenic
1009690928 6:67031176-67031198 TCTGGGAACAAGCTCCCTCTGGG + Intergenic
1012207675 6:96480736-96480758 CCAGGGGATAAGATTCCTCTTGG - Intergenic
1012789677 6:103677352-103677374 TCGGGGAATGAGTTCCCTTTGGG - Intergenic
1013160442 6:107538697-107538719 CCAGTGGCTGAGCTCCCTTTTGG + Intronic
1014489420 6:122043834-122043856 TCAGTGAATTAGCTTCCTCTGGG - Intergenic
1016182819 6:141168247-141168269 TCAGGGGAAGAGCTCCCTCTGGG + Intergenic
1016183522 6:141175220-141175242 TCCAGGGATGAGCTCCCTCTGGG + Intergenic
1016184687 6:141183642-141183664 TCAGGAGATGAGCTCCCTCTGGG + Intergenic
1018054130 6:160036895-160036917 TCTGGGCTTTAGCTCCCTCTGGG - Intronic
1018252232 6:161882477-161882499 TCAGAGGATGAGCTCATTGTGGG - Intronic
1018734831 6:166679880-166679902 ATGGGGGACGAGCTCCCTCTGGG + Intronic
1020000938 7:4755197-4755219 TCACGGGATGAGCTCCAGCAAGG - Intronic
1024085963 7:45891775-45891797 TCATGTGATGTGCTCCCTCTGGG - Intronic
1024263819 7:47591595-47591617 TTAGGGGATAAGCTGCCCCTGGG - Intergenic
1024458758 7:49638216-49638238 TGAGAGGATGAGCACCCTGTGGG - Intergenic
1025859209 7:65310725-65310747 TGAGGGCATGAGATCCCCCTTGG - Intergenic
1026391576 7:69908015-69908037 ACAAGGAATGACCTCCCTCTTGG + Intronic
1029735847 7:102465331-102465353 TCAGGGGATGAGGCCCCTCGGGG - Intronic
1030094640 7:105887311-105887333 TCAATGGATGAGCTCCATATTGG + Intronic
1031584536 7:123518537-123518559 TCTAGGGCTGATCTCCCTCTTGG + Intronic
1032611878 7:133423868-133423890 TAGGGGGACGAGCTCCCTCTGGG + Intronic
1033275374 7:139967608-139967630 TCAGGGGATCATATTCCTCTGGG - Intronic
1033951291 7:146788120-146788142 TTGGGGGACAAGCTCCCTCTGGG - Intronic
1034467061 7:151236007-151236029 TGAGAGGATGAGCCACCTCTGGG - Intronic
1036837658 8:12088883-12088905 CCGGGGGATGAGCTCTCTCTAGG + Intergenic
1036859451 8:12335131-12335153 CCGGGGGATGAGCTCTCTCTAGG + Intergenic
1037037303 8:14182773-14182795 TCAGGTGATCCGCCCCCTCTCGG - Intronic
1039690378 8:39858598-39858620 TCAGGGAATGTGATCCGTCTTGG + Intergenic
1041145879 8:54875340-54875362 TTAGGAGATGAGCTCCCTCTGGG + Intergenic
1042544859 8:69942350-69942372 TCATGGGAAGAGCTCCGTCTTGG + Intergenic
1043002081 8:74771831-74771853 TCCGGGGACCAGCTCCCTCTGGG - Intronic
1043034421 8:75178637-75178659 TCGAGGGATGAGCTCCCTGTGGG - Intergenic
1044010157 8:86984528-86984550 GCAGGGTATAAGCCCCCTCTTGG - Intronic
1044302888 8:90606335-90606357 TCAGTGGTCAAGCTCCCTCTGGG - Intergenic
1044456009 8:92393796-92393818 CGAGGGGACGAGCTCCCTCTGGG - Intergenic
1044457071 8:92401331-92401353 TCAGGGGATGAGCTCCCTCTGGG - Intergenic
1044457081 8:92401374-92401396 TCAGGGGACGAGCTCCCTCTGGG - Intergenic
1045653424 8:104364010-104364032 TCAGGGGATGAGCTCCCTCTGGG - Intronic
1046055206 8:109071035-109071057 TCGGGGGACGAGCTCCCTCTGGG - Intergenic
1047737654 8:127780709-127780731 TCAGTGGCAGAGCTCCCTGTGGG + Intergenic
1048058956 8:130897535-130897557 TCAGGCAATGAGATCCTTCTTGG + Intronic
1048291190 8:133182915-133182937 TCAGGGGCTGGGGTCACTCTAGG + Intergenic
1048703031 8:137115840-137115862 TCAGGGGATGAGCTCCCTCTGGG - Intergenic
1049539853 8:143203411-143203433 TAAGGAGCTGAGCTCCATCTTGG - Intergenic
1051889290 9:21926246-21926268 TTAGGGGATGAAGTCCCTTTTGG - Intronic
1051934813 9:22433976-22433998 TTGGGGGATGAGCTCCCTCTGGG + Intergenic
1051935847 9:22441155-22441177 TTGGGGGATGAGCTCCCTCTGGG + Intergenic
1052603647 9:30671485-30671507 CCAGGGGAAGAGCCCCCTCCAGG - Intergenic
1055462073 9:76528770-76528792 TCCAGGTACGAGCTCCCTCTGGG - Intergenic
1057262282 9:93591825-93591847 TCTGGGGTTGAGGTCCCTGTGGG - Intronic
1057293996 9:93824871-93824893 TCAGGGGAAGATGCCCCTCTTGG + Intergenic
1057689512 9:97271314-97271336 TCGGGGTACGAGCTCCCTCTGGG - Intergenic
1058065128 9:100540432-100540454 TCAGGGAACAAGCTCCCTCTGGG - Intronic
1058838261 9:108879198-108879220 TCAGGGGAGGAACTGCCTCGTGG + Intronic
1060193634 9:121608866-121608888 TTTGGGGAGGAGCCCCCTCTGGG + Intronic
1060410954 9:123399894-123399916 TCTGGGCCTGAGCTCCCACTCGG + Intronic
1061616090 9:131780072-131780094 TCAAGTGATCAGCCCCCTCTTGG + Intergenic
1062206869 9:135342307-135342329 CCAGGGGACGAGCTCCTTCTTGG - Intergenic
1186544280 X:10432966-10432988 CCAGGGGATGAGCTCTCACACGG + Intergenic
1189187895 X:39070058-39070080 TGGGGGAACGAGCTCCCTCTGGG - Intergenic
1190265399 X:48824875-48824897 TCATGATATCAGCTCCCTCTTGG - Exonic
1192043992 X:67652715-67652737 TCAGGGACTAAGCTCCTTCTAGG - Intronic
1192434104 X:71132069-71132091 CCAGGAGATGAACTCCCTCTTGG + Exonic
1193265605 X:79464560-79464582 TCACAGGAGGAGCTCCCTCTAGG + Intergenic
1193962169 X:87939748-87939770 CTAAGGGATGAGCTCCCTCTGGG - Intergenic
1194035350 X:88864024-88864046 TCGGGTAATGAGCTCCCTCTGGG + Intergenic
1194077710 X:89417223-89417245 TCAGGGAATGAGCTCCTTCTGGG + Intergenic
1194185122 X:90765784-90765806 CTGGAGGATGAGCTCCCTCTGGG + Intergenic
1194451143 X:94045983-94046005 TGGGGGGATGAGCTCCCTCTGGG + Intergenic
1194857837 X:98956311-98956333 TCAGGGAATGGGCTCCCCTTTGG + Intergenic
1196663660 X:118294477-118294499 GTCTGGGATGAGCTCCCTCTGGG - Intergenic
1196741303 X:119028488-119028510 ATCGGGGACGAGCTCCCTCTGGG - Intergenic
1198680442 X:139176096-139176118 TCAGGGAATCAGCTGCTTCTAGG + Intronic
1198777129 X:140191918-140191940 TCAGGGTGTTAGCACCCTCTGGG + Intergenic
1199437447 X:147828645-147828667 GTCTGGGATGAGCTCCCTCTGGG - Intergenic
1200383550 X:155865497-155865519 ATCCGGGATGAGCTCCCTCTGGG + Intergenic
1200531749 Y:4347895-4347917 CTGGGGGATGAGCTCCCTCTGGG + Intergenic
1202090503 Y:21183543-21183565 TCAGGGGATGAGCTCCCTCTGGG + Intergenic
1202242464 Y:22785715-22785737 TCAGAGGATGAGCTCCCTCTGGG + Intergenic
1202395449 Y:24419464-24419486 TCAGAGGATGAGCTCCCTCTGGG + Intergenic
1202475335 Y:25250628-25250650 TCAGAGGATGAGCTCCCTCTGGG - Intergenic