ID: 1045653425

View in Genome Browser
Species Human (GRCh38)
Location 8:104364011-104364033
Sequence ATCAGGGGATGAGCTCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 5, 1: 19, 2: 26, 3: 49, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045653425_1045653427 -9 Left 1045653425 8:104364011-104364033 CCAGAGGGAGCTCATCCCCTGAT 0: 5
1: 19
2: 26
3: 49
4: 158
Right 1045653427 8:104364025-104364047 TCCCCTGATCAAGCACAGCAGGG No data
1045653425_1045653426 -10 Left 1045653425 8:104364011-104364033 CCAGAGGGAGCTCATCCCCTGAT 0: 5
1: 19
2: 26
3: 49
4: 158
Right 1045653426 8:104364024-104364046 ATCCCCTGATCAAGCACAGCAGG No data
1045653425_1045653432 15 Left 1045653425 8:104364011-104364033 CCAGAGGGAGCTCATCCCCTGAT 0: 5
1: 19
2: 26
3: 49
4: 158
Right 1045653432 8:104364049-104364071 TTGCGGAACCCCCGTCCACCTGG No data
1045653425_1045653431 -2 Left 1045653425 8:104364011-104364033 CCAGAGGGAGCTCATCCCCTGAT 0: 5
1: 19
2: 26
3: 49
4: 158
Right 1045653431 8:104364032-104364054 ATCAAGCACAGCAGGGCTTGCGG No data
1045653425_1045653437 27 Left 1045653425 8:104364011-104364033 CCAGAGGGAGCTCATCCCCTGAT 0: 5
1: 19
2: 26
3: 49
4: 158
Right 1045653437 8:104364061-104364083 CGTCCACCTGGAACCCACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045653425 Original CRISPR ATCAGGGGATGAGCTCCCTC TGG (reversed) Intronic
902363758 1:15957481-15957503 AGCAGGGGCTGAGCTCGCCCAGG + Intronic
904263838 1:29306601-29306623 AGCAGGGCTTGAGCTGCCTCTGG + Intronic
906475137 1:46164464-46164486 AGCAGGAGATAAGCTCCCTGTGG - Intronic
909863265 1:80634533-80634555 CTTAGGGGATGAGCCCTCTCAGG + Intergenic
910468838 1:87529177-87529199 ATCAGGAGATGAGTTCCCTCTGG - Intergenic
912069871 1:105796030-105796052 ATTTGGGGATGAGCTCCCTCTGG + Intergenic
912734802 1:112141269-112141291 AGGAGGGAATGAGCTACCTCTGG + Intergenic
915098955 1:153484807-153484829 GTCAGGGGAAGAGCTCCCCAAGG - Intergenic
915317859 1:155039660-155039682 ATATGGGGAGGAGCTCCCTCAGG - Intronic
917077162 1:171217830-171217852 CTTAGGGGATGAGCCCTCTCTGG - Intergenic
917767844 1:178243281-178243303 AGCAGGGAATGAGCTTCCCCAGG + Intronic
917961729 1:180151014-180151036 ATCAGGGCATGTTCACCCTCTGG + Intergenic
919808656 1:201395932-201395954 TTCAGCTGTTGAGCTCCCTCTGG - Intronic
923020954 1:230163389-230163411 AGCATGGGATGAGGTCACTCCGG + Intronic
923161388 1:231317581-231317603 ACTTGGGGATGAGCTCCCTCTGG + Intergenic
923450116 1:234109427-234109449 ATGAGGAGATGAGCTGCCTATGG - Intronic
923914264 1:238485167-238485189 CTCAGAGGATGAGCCCTCTCTGG - Intergenic
1062989181 10:1799660-1799682 ATGAGGGGATGAGATCCTTCAGG + Intergenic
1069677621 10:70259970-70259992 AGCAGGGGAAGGGCACCCTCTGG - Intronic
1070592101 10:77808669-77808691 ATCAGGGGGTGCTCGCCCTCAGG - Intronic
1070700618 10:78599183-78599205 TTCAGGGGCTGAGGTCCCTTGGG + Intergenic
1070917164 10:80162223-80162245 ATCAGGGGCTGAGATCCCACAGG + Intronic
1071089127 10:81898301-81898323 ATCAGGGGAAGAGCACATTCTGG + Intronic
1071565227 10:86668197-86668219 ACCAGGGGCTGAGCTCCCTTGGG - Intergenic
1073125870 10:101148803-101148825 ATCAAGGGCTCAGATCCCTCAGG - Intergenic
1073970351 10:109040871-109040893 ACTGGGGGATGAGCTCCCTCTGG + Intergenic
1073971403 10:109048133-109048155 ATCGGGAGATGAGCTCCCTCTGG + Intergenic
1075513358 10:123089897-123089919 ATCAGGGGATGAGCTCTCTGAGG + Intergenic
1075609681 10:123842351-123842373 CTCAAGGGAGGAACTCCCTCTGG - Exonic
1076051071 10:127333575-127333597 TTTGGGGGATGATCTCCCTCTGG + Intronic
1076946621 10:133656201-133656223 GGCAAGGGAAGAGCTCCCTCAGG + Intergenic
1077050219 11:563108-563130 ACCAGGGAAAGTGCTCCCTCCGG + Intronic
1077167662 11:1151045-1151067 AGCAGGGTCTCAGCTCCCTCTGG + Intergenic
1077537889 11:3133259-3133281 ATCAGGGGCTGTGCTCCCTGGGG - Intronic
1077792661 11:5458380-5458402 ATCAGGTGATGTGATGCCTCTGG + Intronic
1079083201 11:17428224-17428246 TCCAGGTGCTGAGCTCCCTCTGG + Intronic
1083110786 11:60404627-60404649 ATCAGAGGATCAGCTTCTTCCGG + Intronic
1086296102 11:85369703-85369725 CTTAGGGGATGAGCTCTCTCTGG + Intronic
1086951125 11:92890965-92890987 ATCCGAGGATGAGGTGCCTCTGG - Exonic
1087318856 11:96635928-96635950 ATCGGGGGACAAGCTCCCTCTGG + Intergenic
1087962240 11:104366450-104366472 ATCAGGGGATGAGCTCCCGCTGG - Intergenic
1088716760 11:112555584-112555606 ATCAGGTGAACAGCTGCCTCTGG + Intergenic
1095709125 12:45269403-45269425 ATAAGGGCATAAGCTACCTCTGG - Intronic
1096408276 12:51359293-51359315 AGCAGGGGATGATCTCCAGCTGG + Exonic
1098436069 12:70468987-70469009 CTTAGGGGATGAGCCCTCTCTGG + Intergenic
1099437254 12:82659456-82659478 AATCAGGGATGAGCTCCCTCTGG - Intergenic
1100612555 12:96203399-96203421 ATCAGTCTGTGAGCTCCCTCTGG + Intronic
1101637238 12:106554570-106554592 AGCAGGGAAAGTGCTCCCTCAGG + Intronic
1103296962 12:119895983-119896005 AGCAGGGGATACACTCCCTCGGG + Intergenic
1103967247 12:124647636-124647658 ATCAGCAGGTGTGCTCCCTCTGG + Intergenic
1105806153 13:23952841-23952863 ATCGGGGGATGAGCTCCCTCTGG - Intergenic
1106163369 13:27219883-27219905 ATTGGGGTATGAGCTCCCTCTGG + Intergenic
1106251562 13:27986080-27986102 TTCTGGGGAGGAGCTCCCTGTGG - Intronic
1108817804 13:54313197-54313219 ATCAGGGAATGAGCTTGCTCTGG + Intergenic
1108818498 13:54318008-54318030 ATTGGGGGATGAGCTCCCTCTGG + Intergenic
1108855483 13:54787879-54787901 ACTGGGGGATGAGCTCCCTCTGG - Intergenic
1109534088 13:63693784-63693806 ATTGGGGGACAAGCTCCCTCTGG - Intergenic
1109745043 13:66613628-66613650 CTTAGGGGATGAGCCCTCTCAGG + Intronic
1109935680 13:69280956-69280978 ATAAGGGGAAGAGCTGCCTATGG + Intergenic
1111096066 13:83517054-83517076 ATGGGGGGACGATCTCCCTCTGG + Intergenic
1111103255 13:83613635-83613657 ATCAGGGGACGAGTTCCCTCTGG - Intergenic
1111232608 13:85363283-85363305 ATTAGGGGACCAGCTCCCTCTGG + Intergenic
1112549738 13:100408643-100408665 CTTAGGGGATGAGCCCTCTCTGG - Intronic
1114566354 14:23635888-23635910 ACTGGGGGATGAGCTCCCTCTGG + Intronic
1115284911 14:31705834-31705856 ATCGGGGGATGTGCTCCTTCTGG - Intronic
1115285880 14:31712373-31712395 ATCAGGGGACGAACTCCCTCTGG - Intronic
1117562361 14:56954144-56954166 TGGAGGGCATGAGCTCCCTCTGG + Intergenic
1121703041 14:95970609-95970631 CTCTGGAGATTAGCTCCCTCTGG + Intergenic
1122081656 14:99271158-99271180 TACGGGTGATGAGCTCCCTCTGG + Exonic
1202924207 14_KI270724v1_random:8826-8848 GGCAAGGGAAGAGCTCCCTCAGG - Intergenic
1123434109 15:20242586-20242608 AAAAGGTGATGAGCTCCCTTGGG - Intergenic
1124051684 15:26202361-26202383 ATGCTGGGATGAGCTCCCTCCGG - Intergenic
1126191815 15:45886090-45886112 ATAGGGGTAGGAGCTCCCTCTGG + Intergenic
1127894838 15:63288254-63288276 ATTAGAGGATAAGCTCCCTGAGG - Intronic
1130162365 15:81414160-81414182 ATCTGGGGACGAGCTCCCTCTGG + Intergenic
1131061961 15:89409906-89409928 TGCAGGGGATGAGCTTCCCCAGG + Intergenic
1135338956 16:21630215-21630237 ATCGGGGGACAAGCTCCCACTGG - Intronic
1135340048 16:21637602-21637624 ATCAGGGGACAAGCTCCCTCTGG - Intronic
1136850502 16:33608529-33608551 AAAAGGTGATGAGCTCCCTTGGG + Intergenic
1137256223 16:46777832-46777854 AGCAGGGGCGGGGCTCCCTCAGG - Intronic
1138633821 16:58320561-58320583 TTTAGAAGATGAGCTCCCTCAGG - Intronic
1139437313 16:66943675-66943697 AACAGGAAATAAGCTCCCTCTGG - Intronic
1140472970 16:75225271-75225293 GTGGGGGGATGAGCTCACTCTGG + Intergenic
1203055702 16_KI270728v1_random:924962-924984 AGCAAGGGCTGAGCTCCCACGGG + Intergenic
1203112116 16_KI270728v1_random:1456982-1457004 AAAAGGTGATGAGCTCCCTTGGG + Intergenic
1144457098 17:15427843-15427865 ACGAGGGGATGAGCTGCCTCAGG + Intergenic
1145220637 17:21085753-21085775 ATCGGGGGACAAGCTCCCTCTGG - Intergenic
1148231115 17:45935598-45935620 ATCAGGGGACCGGCTCCCTAAGG - Intronic
1151435482 17:74093297-74093319 ATCAGGGAATGACCACCCTGTGG + Intergenic
1153061975 18:1004260-1004282 ATCATGGGAGCAGATCCCTCAGG - Intergenic
1153674088 18:7440171-7440193 AACAGGCGAGGAGCTGCCTCTGG - Intergenic
1155386348 18:25282245-25282267 ATGAGGGGATCAGCTGCCTTTGG + Intronic
1155865337 18:30957765-30957787 ATCAGAGGCTGAGCTCCTTCTGG - Intergenic
1157821798 18:50776600-50776622 CTGAGGGGATGAGCCCTCTCGGG + Intergenic
1158730612 18:60018460-60018482 ATCTGGGGATGAGGTGCTTCTGG - Intergenic
1159346706 18:67215761-67215783 ATGGGGGGACCAGCTCCCTCTGG - Intergenic
1162812058 19:13170178-13170200 AGCAGAGGATGGGCTCACTCGGG - Intergenic
1164189492 19:22901562-22901584 CTCAGGGGATGAGCCCCCAGCGG - Intergenic
1166375112 19:42323668-42323690 GTCAGCGGATTGGCTCCCTCCGG - Exonic
925839370 2:7977191-7977213 AGCAGGGAATGAGCTAGCTCAGG + Intergenic
928282752 2:29963603-29963625 TTCAGGGCAGGGGCTCCCTCAGG + Intergenic
928793863 2:34992171-34992193 ATCAGGGGAGGAACTCCCTCTGG + Intergenic
929176380 2:38981033-38981055 ATCAGGGGATTGGCTCTCTAAGG + Intergenic
929993587 2:46811077-46811099 AGCAGAGGATGAGCCCCCTGGGG + Intergenic
930534930 2:52633300-52633322 AGCAGGGTATGTGCTCCCTCTGG + Intergenic
930585173 2:53259734-53259756 ATCAGGGGACCAGCTCCCTCTGG - Intergenic
933797204 2:85929163-85929185 ATCAGGGGATGAGCTCCCTCTGG - Intergenic
933989235 2:87621777-87621799 ATCAGGGGAAATCCTCCCTCTGG + Intergenic
934659907 2:96137894-96137916 CTCAGGGAAGGAGCTCCCTTAGG + Intronic
936304608 2:111329049-111329071 ATCAGGGGAAATCCTCCCTCTGG - Intergenic
938153141 2:128903758-128903780 ATCAGGTGATGAGCTCCCTCTGG - Intergenic
938177186 2:129144482-129144504 ATCCGGGGATGAGCTCCCTCTGG - Intergenic
939862396 2:147435762-147435784 ATGAGGGAATGAGCTCCTACTGG + Intergenic
941245137 2:163086796-163086818 AATAGGATATGAGCTCCCTCTGG - Intergenic
942903011 2:181145707-181145729 ATCGTGGGAGGAGCTCCCTCTGG - Intergenic
944237134 2:197450827-197450849 ATCCAGGGACGAGCTCCCTCTGG + Intergenic
944688215 2:202136589-202136611 ATCGGGGGATGAGCTCCCTCTGG - Intronic
947988482 2:234468414-234468436 ATCAGGGAATGAGTTCCTCCAGG - Intergenic
948989080 2:241542633-241542655 ATCAGATGAAGAGCTGCCTCTGG - Intergenic
949053842 2:241913783-241913805 CTCAGGGGAGGAGCCCCTTCCGG + Intergenic
1169227982 20:3867969-3867991 ATCAGGGGCTGGGCTCACTGTGG + Exonic
1173668985 20:44784507-44784529 AACAGGGGATGTGCTGCCTAAGG - Intronic
1175240836 20:57547483-57547505 CACATGGGATGACCTCCCTCGGG - Intergenic
1175850008 20:62085196-62085218 ATCAGGGTGTCAGCTCCTTCTGG - Intergenic
1175861620 20:62153335-62153357 ATCAGGGCATGAGTAACCTCAGG + Intronic
1175933444 20:62504153-62504175 CTCAGGGGGAGAGCTCCTTCTGG + Intergenic
1177580966 21:23021570-23021592 ATCGGGGGATGAGCTCCCTCTGG - Intergenic
1177715969 21:24840322-24840344 ATTGGGGGACGAGCTCCCTCTGG - Intergenic
1178734146 21:35133701-35133723 ATTAGGGTGTGAGCTCCCTAAGG + Intronic
1179780864 21:43700068-43700090 ATCAGGGGCTGAGCACTGTCAGG - Intergenic
1181939667 22:26465396-26465418 ATCACGCGATGGGGTCCCTCAGG + Intronic
1183964778 22:41435097-41435119 CTCAGGTGAGCAGCTCCCTCTGG + Exonic
1184073317 22:42160502-42160524 ATCAAGGGATGACCCTCCTCTGG - Exonic
949133604 3:536012-536034 ATCGGGGGATGAGCTCCCTGTGG - Intergenic
950583289 3:13876989-13877011 CTGAGAGGATGAGCTCCCTGAGG + Intronic
954596413 3:51829438-51829460 TTCAGGTGATCATCTCCCTCTGG - Exonic
955032158 3:55232090-55232112 ATCAGGAAATGAGCTCCCTAGGG - Intergenic
957080833 3:75634208-75634230 GGCAAGGGAAGAGCTCCCTCAGG - Intergenic
957080851 3:75634276-75634298 GGCAAGGGAAGAGCTCCCTCAGG - Intergenic
957271007 3:78030053-78030075 ATCGGGGGACGAGCACCCTCTGG + Intergenic
957919863 3:86733294-86733316 ATCAGGGGAGGAGCTCCCTCTGG - Intergenic
960138202 3:114126519-114126541 AGCAGGAAATGAGCTCCCTGAGG + Intergenic
961584257 3:127909375-127909397 ACCTGGGGATGAGATCCCTGGGG - Intergenic
962106626 3:132396543-132396565 ATCCAGGGATGAGCTCCCTCTGG + Intergenic
964130537 3:153281527-153281549 ATTGGGGTATGAGCTCCCTCTGG + Intergenic
964979886 3:162665823-162665845 CTTAGGGAATGAGCTCTCTCTGG + Intergenic
965139249 3:164814371-164814393 ATTGGCGGATGAGCTCCCTCTGG + Intergenic
965139861 3:164818597-164818619 ATCAGGGGACGAGCTCCCTCTGG + Intergenic
966448882 3:180035976-180035998 TTCAGGGGAGGTGCTGCCTCCGG - Intronic
966750145 3:183314036-183314058 ATCAGGAGCTGAGCTCTCCCAGG + Intronic
967317315 3:188161541-188161563 AACAAGGGATCAGCTCACTCTGG - Intronic
972784628 4:42315299-42315321 ATCTGGGGACGAGCTCCCTCTGG - Intergenic
972790858 4:42369762-42369784 ATCAGGGGACGAGCTCTCTCTGG + Intergenic
975033902 4:69658174-69658196 ATCAGGGAACGAGCTCCCTCTGG - Intergenic
975132390 4:70842232-70842254 CTCAGGGGTTGAGGCCCCTCTGG + Intergenic
975200412 4:71581613-71581635 TTGAGGGAATGAGCTACCTCTGG - Intergenic
976596995 4:86904149-86904171 ATCTCGGGATGAGCTCCTTCTGG - Intronic
977370282 4:96126322-96126344 ATAGGGGGATGAGCTCCCTCTGG - Intergenic
978944743 4:114481943-114481965 ACTGGGGGATGAGCTCCCTTTGG - Intergenic
980158470 4:129133547-129133569 ACCAGGGGAAGAGCGCCCTCAGG + Intergenic
980328454 4:131379480-131379502 CTCAGGGGAGGAGCTCACTCTGG + Intergenic
980809242 4:137853727-137853749 ATCAGGGGAGGAGCTCCCTCTGG + Intergenic
982024346 4:151236354-151236376 ATTGGGGGATGAGCTCCCTCTGG + Intronic
982630245 4:157822127-157822149 ATCAGGGGAAGAGCTCCCTCTGG + Intergenic
982701777 4:158665066-158665088 ATCGAGGAACGAGCTCCCTCTGG + Intergenic
982773696 4:159421022-159421044 ATCGGGGGATGAGCTCCCTCTGG + Intergenic
983660648 4:170127840-170127862 ATCTGGGGATGAGCTCCCTCTGG - Intergenic
985322972 4:188735145-188735167 ATCAGGGGGCGAGCTCCCTCTGG - Intergenic
985423539 4:189807111-189807133 ATACGGGGACGAGCTCCCTCTGG - Intergenic
985450040 4:190056863-190056885 GTCAAGGGAAGAGCTCCCTCAGG + Intergenic
985450057 4:190056932-190056954 GCCAAGGGAAGAGCTCCCTCAGG + Intergenic
985450075 4:190057000-190057022 GGCAAGGGAAGAGCTCCCTCAGG + Intergenic
985702195 5:1380402-1380424 ATCTGGGGATGAGCTCCCTCTGG - Intergenic
988591397 5:32553008-32553030 ATTAGGGGACAAGCTCCCTCTGG - Intronic
988899987 5:35721819-35721841 GTTAGGGGATGAGCCCTCTCTGG - Intronic
989207147 5:38821990-38822012 ATTGGGGGATGAGCTCCCTCTGG + Intergenic
991120574 5:63008476-63008498 ATGGGGGGACGAGCTCCCTCTGG + Intergenic
992845716 5:80744904-80744926 ATCACTGAATGAACTCCCTCTGG - Intronic
994754613 5:103779013-103779035 ATCCTGGGAGGAGCTCGCTCTGG - Intergenic
995705978 5:114989811-114989833 ATCGGGGGACGAGCTCTCTCTGG + Intergenic
997329336 5:133047683-133047705 ATGGGGGGATGAACTCCCTCTGG + Intergenic
998363982 5:141616920-141616942 AAAAGGGGTTGAGCTTCCTCAGG + Intronic
999007928 5:148002661-148002683 CTGAGGGGATGAGCCCTCTCAGG + Intergenic
999253002 5:150193623-150193645 ATCAGTGGATTCCCTCCCTCAGG + Intronic
999443215 5:151619140-151619162 ATCAGAGCATGAGTTCCCTGTGG - Intergenic
999831961 5:155328816-155328838 ATAAGGGGAAGAGCTGTCTCAGG - Intergenic
1001080141 5:168661515-168661537 AGCAGGGGATGTGGTCCCTATGG - Intergenic
1001257465 5:170195075-170195097 ATATGGGGAGGAGCTCTCTCTGG + Intergenic
1002069164 5:176668622-176668644 ATCTCGGGATCAGCTCCCTTGGG - Intergenic
1003201486 6:3965257-3965279 ATCAGGAAATGACCTCCCCCTGG - Intergenic
1003501320 6:6705334-6705356 AACATGGGATGAGCTGCCTAAGG - Intergenic
1004169088 6:13281914-13281936 ATCAGGGGCTCAGCCGCCTCTGG - Intronic
1006221437 6:32495388-32495410 ATTGAGGGATGAGCTCCCTCTGG - Intergenic
1006441595 6:34056792-34056814 ATCAGAGGATGTGCTCCTCCTGG - Intronic
1007299952 6:40860305-40860327 ATCAGCTGAGGAGCTCCCTAAGG + Intergenic
1007532378 6:42554315-42554337 ACTGGGGGACGAGCTCCCTCTGG + Intergenic
1008290430 6:49708620-49708642 CTCCTGGGCTGAGCTCCCTCTGG - Intronic
1008713840 6:54264151-54264173 ATCAGAGGATGATCTGCCTATGG + Intronic
1009690927 6:67031175-67031197 ATCTGGGAACAAGCTCCCTCTGG + Intergenic
1012117963 6:95327708-95327730 ATCAGAATATGAGCTCCCTAAGG - Intergenic
1012789678 6:103677353-103677375 ATCGGGGAATGAGTTCCCTTTGG - Intergenic
1015525095 6:134168293-134168315 AGCTAGGGATGAGCTCCTTCAGG + Intergenic
1016182818 6:141168246-141168268 ATCAGGGGAAGAGCTCCCTCTGG + Intergenic
1016183521 6:141175219-141175241 ATCCAGGGATGAGCTCCCTCTGG + Intergenic
1016184686 6:141183641-141183663 ATCAGGAGATGAGCTCCCTCTGG + Intergenic
1018054131 6:160036896-160036918 ATCTGGGCTTTAGCTCCCTCTGG - Intronic
1018156324 6:160988641-160988663 ATGAAGGGGTGTGCTCCCTCAGG + Intergenic
1018890515 6:167978287-167978309 AGCAGGGGCCGAGCTCCCCCGGG + Intergenic
1021331181 7:19340453-19340475 TTGAGGGGATGAGCCCTCTCAGG + Intergenic
1022143732 7:27515986-27516008 ATCAGAGGATTTGCTCTCTCTGG + Intergenic
1022338956 7:29450590-29450612 ATCGAGGGCTGTGCTCCCTCTGG - Intronic
1022581540 7:31560135-31560157 ATCTGGGGATGAGCTGTTTCAGG + Intronic
1024085964 7:45891776-45891798 GTCATGTGATGTGCTCCCTCTGG - Intronic
1024369037 7:48559111-48559133 TTCAGGGGGTGAGTTCCCCCAGG + Intronic
1029436950 7:100568860-100568882 ATTCAGGGAGGAGCTCCCTCAGG - Intergenic
1029735848 7:102465332-102465354 TTCAGGGGATGAGGCCCCTCGGG - Intronic
1032611877 7:133423867-133423889 ATAGGGGGACGAGCTCCCTCTGG + Intronic
1033275375 7:139967609-139967631 ATCAGGGGATCATATTCCTCTGG - Intronic
1035085423 7:156253688-156253710 ATCAGGGGAGGGGATCCCTCAGG + Intergenic
1041145878 8:54875339-54875361 ATTAGGAGATGAGCTCCCTCTGG + Intergenic
1043002082 8:74771832-74771854 ATCCGGGGACCAGCTCCCTCTGG - Intronic
1043034422 8:75178638-75178660 ATCGAGGGATGAGCTCCCTGTGG - Intergenic
1044302889 8:90606336-90606358 ATCAGTGGTCAAGCTCCCTCTGG - Intergenic
1044456010 8:92393797-92393819 TCGAGGGGACGAGCTCCCTCTGG - Intergenic
1044457072 8:92401332-92401354 ATCAGGGGATGAGCTCCCTCTGG - Intergenic
1044457082 8:92401375-92401397 ATCAGGGGACGAGCTCCCTCTGG - Intergenic
1045653425 8:104364011-104364033 ATCAGGGGATGAGCTCCCTCTGG - Intronic
1045976807 8:108138497-108138519 CACAGGGGATGAGCTCCCTGTGG - Intergenic
1046055207 8:109071036-109071058 ATCGGGGGACGAGCTCCCTCTGG - Intergenic
1047870950 8:129081334-129081356 ATAAAGGGATGAACTCCCTCTGG - Intergenic
1048703032 8:137115841-137115863 ATCAGGGGATGAGCTCCCTCTGG - Intergenic
1050318140 9:4424227-4424249 ATCAGGGGCAGAGCTAGCTCTGG - Intergenic
1051934812 9:22433975-22433997 ATTGGGGGATGAGCTCCCTCTGG + Intergenic
1051935846 9:22441154-22441176 ATTGGGGGATGAGCTCCCTCTGG + Intergenic
1055462074 9:76528771-76528793 ATCCAGGTACGAGCTCCCTCTGG - Intergenic
1057262283 9:93591826-93591848 ATCTGGGGTTGAGGTCCCTGTGG - Intronic
1057689513 9:97271315-97271337 ATCGGGGTACGAGCTCCCTCTGG - Intergenic
1058065129 9:100540433-100540455 ATCAGGGAACAAGCTCCCTCTGG - Intronic
1060055647 9:120410544-120410566 ATCAGACTATGAGCTCCCTGAGG + Intronic
1062079864 9:134618127-134618149 AGCTGGAGATGAGCTCCCTGGGG - Intergenic
1189187896 X:39070059-39070081 ATGGGGGAACGAGCTCCCTCTGG - Intergenic
1189988987 X:46577045-46577067 CCCAGGGGAGGAGTTCCCTCAGG - Intronic
1190490723 X:50979927-50979949 CTCAGAGGATGAGCCCTCTCTGG + Intergenic
1193962170 X:87939749-87939771 GCTAAGGGATGAGCTCCCTCTGG - Intergenic
1194035349 X:88864023-88864045 ATCGGGTAATGAGCTCCCTCTGG + Intergenic
1194066114 X:89264541-89264563 ATCAGGAAATGACCTTCCTCTGG - Intergenic
1194077709 X:89417222-89417244 ATCAGGGAATGAGCTCCTTCTGG + Intergenic
1194185121 X:90765783-90765805 ACTGGAGGATGAGCTCCCTCTGG + Intergenic
1194451142 X:94045982-94046004 TTGGGGGGATGAGCTCCCTCTGG + Intergenic
1195328640 X:103778543-103778565 CTCAGGGGATGAAATCCCTGAGG + Intronic
1195943370 X:110183120-110183142 GTCAGGGGAGGACCGCCCTCAGG - Intergenic
1200531748 Y:4347894-4347916 ACTGGGGGATGAGCTCCCTCTGG + Intergenic
1200720284 Y:6598661-6598683 ATCAGGAAATGACCTTCCTCTGG - Intergenic
1202090502 Y:21183542-21183564 ATCAGGGGATGAGCTCCCTCTGG + Intergenic
1202242463 Y:22785714-22785736 ATCAGAGGATGAGCTCCCTCTGG + Intergenic
1202395448 Y:24419463-24419485 ATCAGAGGATGAGCTCCCTCTGG + Intergenic
1202475336 Y:25250629-25250651 ATCAGAGGATGAGCTCCCTCTGG - Intergenic