ID: 1045653428

View in Genome Browser
Species Human (GRCh38)
Location 8:104364026-104364048
Sequence GCCCTGCTGTGCTTGATCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045653428_1045653437 12 Left 1045653428 8:104364026-104364048 CCCCTGATCAAGCACAGCAGGGC 0: 1
1: 0
2: 2
3: 43
4: 183
Right 1045653437 8:104364061-104364083 CGTCCACCTGGAACCCACGCTGG No data
1045653428_1045653442 27 Left 1045653428 8:104364026-104364048 CCCCTGATCAAGCACAGCAGGGC 0: 1
1: 0
2: 2
3: 43
4: 183
Right 1045653442 8:104364076-104364098 CACGCTGGCCGAGAGCGCCCAGG No data
1045653428_1045653432 0 Left 1045653428 8:104364026-104364048 CCCCTGATCAAGCACAGCAGGGC 0: 1
1: 0
2: 2
3: 43
4: 183
Right 1045653432 8:104364049-104364071 TTGCGGAACCCCCGTCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045653428 Original CRISPR GCCCTGCTGTGCTTGATCAG GGG (reversed) Intronic
903370388 1:22831582-22831604 GCCCTGCTCTGCTTGACCTTAGG - Intronic
903891476 1:26573151-26573173 GCCCTCCTGTGCCCCATCAGGGG + Intronic
905658279 1:39700521-39700543 TCCCTGCTGTGCCAGGTCAGAGG - Intronic
906674779 1:47685331-47685353 GCCCTGCTCTGCTCACTCAGTGG - Intergenic
907519722 1:55015317-55015339 GCCCTGCTCTGCTGGATTTGTGG - Intergenic
909806216 1:79876236-79876258 GCCCTGCTGACCTTGGTCTGTGG + Intergenic
910377129 1:86584832-86584854 GCCCAGCATTGCTTGATCACTGG + Intergenic
912069867 1:105796015-105796037 CCCCTCCTGTGCTTGATTTGGGG + Intergenic
915243967 1:154543388-154543410 CCCCTGCTTTGCTTTAACAGCGG + Intronic
916291425 1:163170783-163170805 GCCGTGCTGAGCTTGATCTGAGG - Intronic
918850421 1:189680854-189680876 GGCCTGCTGTGGTGGATCAGTGG - Intergenic
923975273 1:239255759-239255781 CACCTGCTGGGCTTGATCAGAGG - Intergenic
1062816806 10:506831-506853 CGCCAGCTGTGCATGATCAGAGG + Intronic
1063009638 10:2009850-2009872 GCCCTGCTCTGGTTGCTGAGTGG + Intergenic
1063759456 10:9056798-9056820 CGCCTGCTGGGCTTGATCTGGGG + Intergenic
1065426197 10:25606580-25606602 CCCCTACTGTTCTTTATCAGCGG - Intergenic
1067213295 10:44279580-44279602 GTCCTTCTGGGCTTGATCACAGG + Intergenic
1068009985 10:51436231-51436253 GCTCTGCTGTCGTTGATCAGTGG + Intronic
1070772300 10:79089541-79089563 GGACTGCTGTGTTGGATCAGAGG + Intronic
1073181236 10:101584776-101584798 CCCCTGCTGTCCTGGATAAGTGG - Exonic
1074528069 10:114278532-114278554 GCCCTGCTCTGCCTGTTCAGCGG - Intronic
1075389624 10:122083255-122083277 GCCCTGCTGGGCTGCAGCAGGGG - Exonic
1076635757 10:131880887-131880909 GCCCTGCTCTGGTGGAGCAGAGG + Intergenic
1076806112 10:132859662-132859684 GCCCTGCTGTGGCTGCTCCGGGG - Intronic
1076995117 11:293983-294005 ACCCTGCTGTGCCTGCTCTGAGG - Intronic
1077459520 11:2701793-2701815 GCCCTGCTCTTTTTGGTCAGGGG - Intronic
1079598412 11:22282610-22282632 GTCCAGCTGTGGTTGATAAGAGG + Exonic
1080761141 11:35249908-35249930 TCCCTGCTCTTCTGGATCAGAGG - Intergenic
1081106657 11:39078719-39078741 CACCTGCTGGGCTTGATCAGAGG + Intergenic
1086311042 11:85536727-85536749 TGCCTGCTGGGCTTGATCAGAGG + Intronic
1087315713 11:96600039-96600061 CCCCTGCTGTGCTTAGTCATAGG + Intergenic
1087318854 11:96635913-96635935 CGCCTGCTGGGCTTGATCGGGGG + Intergenic
1087962242 11:104366465-104366487 AGCCTGCTGGGCTTGATCAGGGG - Intergenic
1088820234 11:113450341-113450363 ACCCTGCCCTGCTTGGTCAGAGG - Intronic
1089027867 11:115290523-115290545 GCCCTGATGTATTTGATCAGGGG + Intronic
1089954457 11:122556912-122556934 CGCCTGATGGGCTTGATCAGGGG + Intergenic
1090980784 11:131719722-131719744 GTCCTGTTGTGCTCCATCAGTGG + Intronic
1091624019 12:2108990-2109012 GCCCTGCAGAGATTGCTCAGTGG + Intronic
1092126735 12:6079958-6079980 TCCCTGCTGGGCTTTATGAGGGG - Intronic
1095642691 12:44502750-44502772 TGCCTGCTGGGCTTGATCAGAGG - Intergenic
1095898796 12:47306428-47306450 TGCCTGCTGGGCTTGATCAGAGG + Intergenic
1097547565 12:61023519-61023541 TGCCTGATGGGCTTGATCAGAGG + Intergenic
1101322844 12:103688416-103688438 ACTCTGATGTGATTGATCAGAGG + Intronic
1104576089 12:129967011-129967033 GCCCTGCTGTGCTAGAAGGGAGG - Intergenic
1104908423 12:132227965-132227987 GACCTGCTGAGGTTGAGCAGGGG + Intronic
1105237175 13:18567998-18568020 CACCTGCTGGGCTTGATCGGAGG - Intergenic
1105806155 13:23952856-23952878 CACCTGCTGGGCTTGATCGGGGG - Intergenic
1108958227 13:56187624-56187646 CACCTGCTGGGCTTGATCAGAGG + Intergenic
1111103257 13:83613650-83613672 CACCTGCTGGGCTTGATCAGGGG - Intergenic
1111197558 13:84894784-84894806 CACCTGCTGGGCTTGATCAGAGG - Intergenic
1111232606 13:85363268-85363290 CGCCTGCTGGGCTTGATTAGGGG + Intergenic
1112895733 13:104297659-104297681 CCCATGCTTTGCTGGATCAGAGG - Intergenic
1113294318 13:108941181-108941203 GGCCTTCTGTGCCTGATGAGTGG + Intronic
1115110627 14:29817218-29817240 GGCATGCTGTGAGTGATCAGGGG + Intronic
1115284913 14:31705849-31705871 CACCTGCTGGGCTTGATCGGGGG - Intronic
1115285882 14:31712388-31712410 TGCCTGCTGGGCTTGATCAGGGG - Intronic
1115506158 14:34096156-34096178 GGCCTGCAGTGGCTGATCAGAGG - Intronic
1116084394 14:40217081-40217103 AGCCTGCTGGGCTTGATCGGTGG - Intergenic
1116848212 14:49884098-49884120 GCCCTGCTGGGGTGGATCAGAGG - Intergenic
1122795137 14:104202262-104202284 TTCCTGCTGTGCTTGAGCTGTGG + Intergenic
1124159810 15:27258070-27258092 GCCCTGCTGTCCTTGCTAATGGG + Intronic
1128665939 15:69538569-69538591 GCCCTGCTGAGGGTGAACAGAGG - Intergenic
1129746455 15:78025072-78025094 CAGCTGCTGTGCTTGATCATTGG - Intronic
1129973851 15:79804587-79804609 GCCCTGCTGCGCTTAGTCAGTGG - Intergenic
1130897675 15:88183638-88183660 GGCCTGCTGGGGTTGCTCAGTGG + Intronic
1132892262 16:2210148-2210170 GCCCAGCTGTGGTTGCTCTGAGG + Exonic
1133162214 16:3919715-3919737 GCTCTGCTGTGCTTGCTCCAGGG + Intergenic
1135338958 16:21630230-21630252 CGCCTGCTGGGCTTGATCGGGGG - Intronic
1135340050 16:21637617-21637639 TGCCTGCTGGGCTTAATCAGGGG - Intronic
1136691837 16:32038477-32038499 GCCCTGCTGTGGCTGCTCAAAGG + Intergenic
1136792425 16:32982039-32982061 GCCCTGCTGTGGCTGCTCAAAGG + Intergenic
1136877392 16:33871868-33871890 GCCCTGCTGTGGCTGCTCAAAGG - Intergenic
1137549295 16:49426105-49426127 GCTCTGCTGTGCTGGTTAAGAGG + Intergenic
1137589963 16:49687377-49687399 GCCCTGCAGTGCTAGCCCAGGGG - Intronic
1138426769 16:56939479-56939501 GCCCTGCTCTGTTTGGTCTGTGG + Intronic
1140038032 16:71385748-71385770 GCCTTGCTGTGGCAGATCAGAGG - Intronic
1140772891 16:78222292-78222314 GCCCAGCTGTGCCTCATTAGGGG + Intronic
1141611072 16:85181499-85181521 GGCCTCCTGTGCTCAATCAGGGG - Intronic
1142390651 16:89797484-89797506 GCCCTGCTGTCCTTCCTCACAGG + Intronic
1203094631 16_KI270728v1_random:1243504-1243526 GCCCTGCTGTGGCTGCTCAAAGG + Intergenic
1143100006 17:4499551-4499573 GCCCAGTTGTGCCTGAGCAGAGG - Intronic
1146272373 17:31492789-31492811 GCCCAGCTGGCCTTGCTCAGAGG + Intronic
1146693033 17:34889718-34889740 CCCCTCCTGTGCTGGGTCAGGGG - Intergenic
1146735094 17:35232111-35232133 TCCATGCTGTGCTTGGTCACTGG + Intergenic
1149521150 17:57319099-57319121 GCCCTGCTCTGCATAATCACCGG - Intronic
1150507265 17:65712080-65712102 GCCCTTCCCTGCTTGGTCAGAGG + Intronic
1150942636 17:69709529-69709551 GCCCTACTGTGCAAGAACAGAGG - Intergenic
1152756657 17:82089870-82089892 CCCCTGCTGTGTTTGACCCGTGG + Intronic
1152854055 17:82653887-82653909 GCCTCGCTGTGCATGCTCAGGGG - Intergenic
1152865046 17:82717238-82717260 GCCCTGCGGTGCTGGTTAAGTGG + Intronic
1153833233 18:8941369-8941391 TCCCTGCTGTGGTGGAGCAGAGG - Intergenic
1153947548 18:10030963-10030985 GCTCTGCTGTGATTGGTCTGGGG + Intergenic
1157222822 18:45839516-45839538 GCCCTGCAGTGCGTGCTGAGCGG + Intronic
1158049105 18:53193924-53193946 GCCCTGCTGTCATTTATTAGAGG - Intronic
1161221518 19:3120240-3120262 GCCCTGCTGTCCCTGGGCAGGGG + Intronic
1161702401 19:5802625-5802647 GCCCTGCTGTGTGTGTGCAGGGG + Intergenic
1162760824 19:12887258-12887280 GCCTTGCTTTGCCTTATCAGAGG - Intergenic
1162792656 19:13071054-13071076 GCCCTCCAGAGCTGGATCAGTGG - Intronic
1164266763 19:23626079-23626101 TCTCTGCTCTGCTTAATCAGCGG + Intronic
1165086136 19:33348806-33348828 TCCCTGCTGGGTTTGATCTGTGG + Intergenic
1168403744 19:56100272-56100294 GCCCTGCAGTGCTGGGTCATGGG - Intronic
926763748 2:16303987-16304009 GCCCTGCTGTGGTCCACCAGAGG + Intergenic
928140454 2:28724004-28724026 GACCTCCTGTGGTTGATCTGTGG - Intergenic
928793860 2:34992156-34992178 TGCCTGCTGGGCTTGATCAGGGG + Intergenic
930585175 2:53259749-53259771 CACCTGCTGGGCTTCATCAGGGG - Intergenic
932143117 2:69296972-69296994 CCCCTGCTGTGGGTGCTCAGAGG - Intergenic
933797206 2:85929178-85929200 TGCCTGCTGGGCTTGATCAGGGG - Intergenic
937150845 2:119684631-119684653 GCCTTGCTGTAATTGCTCAGAGG - Intronic
937333130 2:121044477-121044499 GCCCTGCTGTGCCTGGGCAGGGG - Intergenic
938177188 2:129144497-129144519 CGCCTGCTGGGCTTGATCCGGGG - Intergenic
938512600 2:131966515-131966537 CACCTGCTGGGCTTGATCGGAGG + Intergenic
940453823 2:153872222-153872244 CGCCTGCTGGGCTTGATCTGAGG + Exonic
942634120 2:177983337-177983359 GACCTGCTGTGTTTGTTAAGTGG + Intronic
943224531 2:185152927-185152949 TCCCAGCTGTGCTTGATCACTGG + Intergenic
944688217 2:202136604-202136626 CGCCTGCTGGGCTTGATCGGGGG - Intronic
947845182 2:233237980-233238002 GCCCTGCTGTGCTTCGTCATTGG + Intronic
948608761 2:239153894-239153916 GCCCTGCTGTTCACCATCAGAGG - Intronic
948737557 2:240019119-240019141 GCCCTGCTGTGTCTGGGCAGAGG + Intronic
948856655 2:240733387-240733409 GCCCTGCAGGGCCTGAGCAGGGG - Intronic
1168853522 20:993002-993024 GCCCTTCTGAGCCTGATCTGGGG - Intronic
1170495039 20:16915683-16915705 GCCCTGCTGTGCCTGAGCCTGGG - Intergenic
1171522840 20:25788491-25788513 GGACTGTTGTGCTTGCTCAGGGG + Intronic
1171553987 20:26067392-26067414 GGACTGTTGTGCTTGCTCAGGGG - Intergenic
1172850423 20:37958497-37958519 GCTCTGCTGAACTTGATTAGTGG - Intergenic
1175422971 20:58847064-58847086 GACCACCTGTGCTTGAACAGTGG - Intronic
1175501021 20:59450823-59450845 GCCCTGGTGTGATTTCTCAGGGG + Intergenic
1176104669 20:63380351-63380373 GCCATGCTGTGGGTGATGAGAGG + Intergenic
1176781162 21:13196280-13196302 CACCTGCTGGGCTTGATCGGAGG - Intergenic
1177978855 21:27885430-27885452 CGCCTGCTGGGCTTGATCGGAGG - Intergenic
1178972069 21:37188964-37188986 ACACTGCTGTGCTGGAACAGTGG + Intronic
1184137962 22:42560548-42560570 GCCATGCTCTGCTGGATCTGGGG + Intronic
1185059620 22:48599496-48599518 GCCATGCTGAGTCTGATCAGCGG - Intronic
1185132193 22:49045530-49045552 CCCGTGCTGTGCCTGAGCAGAGG - Intergenic
949133606 3:536027-536049 CGCCTGCTGGGCTTGATCGGGGG - Intergenic
950905029 3:16530365-16530387 TCCCTGCTGTGCTGGGTCATTGG + Intergenic
953488772 3:43328905-43328927 GCCCTGCCCTGCTTCATCTGTGG - Intronic
954427156 3:50449485-50449507 GCCCTGCTGAGATTCCTCAGGGG + Intronic
954780022 3:53051874-53051896 GGCCTGCTGTCAGTGATCAGCGG + Intronic
955981685 3:64533737-64533759 GCCCTGCTGTGCTTAGTACGCGG - Intronic
956335166 3:68155235-68155257 ACTCTGCAGTGCCTGATCAGTGG + Intronic
956683501 3:71803474-71803496 GCCCTGCTCTGCTTGTGCAGAGG + Intergenic
957919866 3:86733309-86733331 CACCTGCTGGGCTTGATCAGGGG - Intergenic
961519671 3:127459650-127459672 GCACTCCTGTGCTTCCTCAGAGG - Intergenic
961692169 3:128677930-128677952 GCCCTGAAGTGCTTAATCAAAGG + Intronic
963953556 3:151228567-151228589 GCCCAGCAGTGCTTGAACAAGGG + Intronic
966502117 3:180654559-180654581 GCCCCGTGGTGCTTAATCAGGGG + Intronic
967822069 3:193847549-193847571 CACATGCTGTGCTTGATTAGTGG - Intergenic
969781769 4:9409863-9409885 TGCCTGCTGGGCTTGACCAGGGG - Intergenic
970933492 4:21540781-21540803 GCCCTGCTGTAGGTGTTCAGAGG + Intronic
971798560 4:31259358-31259380 CGCCTGCTGGGCTTGATCAGAGG + Intergenic
972784630 4:42315314-42315336 CGCCTGCTGGGCTTGATCTGGGG - Intergenic
972790856 4:42369747-42369769 CGCCTGCTGGGCTTGATCAGGGG + Intergenic
976741415 4:88361039-88361061 TACCTGCTGGGCTTGATCCGAGG + Intergenic
979292150 4:118990296-118990318 GCAGTGCTGTGGTTGCTCAGAGG + Intronic
980419040 4:132535805-132535827 GCCATGCAGTGCTGGATCACTGG - Intergenic
980809239 4:137853712-137853734 CGCCTGCTGGACTTGATCAGGGG + Intergenic
982630243 4:157822112-157822134 TGCCTGCTGGGCTTGATCAGGGG + Intergenic
982700713 4:158657597-158657619 CACCTACTGGGCTTGATCAGGGG + Intergenic
983660650 4:170127855-170127877 CGCCTGCTGGGCTTGATCTGGGG - Intergenic
984095497 4:175428057-175428079 CGCCTGCTGGGCTTGATCGGGGG + Intergenic
985322975 4:188735160-188735182 TGCCTGCTGGGCTTGATCAGGGG - Intergenic
985702197 5:1380417-1380439 CGCCTGCTGGGCTTGATCTGGGG - Intergenic
986503846 5:8429620-8429642 GCCCTGCTCTGCTTGAACCCGGG + Intergenic
987923681 5:24314417-24314439 AGCCTGCTGGGCTTGATCAGAGG + Intergenic
988605944 5:32678527-32678549 CACCTGCTAGGCTTGATCAGAGG - Intergenic
989757648 5:44975119-44975141 TGCCTGCTGGGCTTGATCGGAGG + Intergenic
992175199 5:74143086-74143108 GCCATGCTGATGTTGATCAGTGG - Intergenic
992669443 5:79044120-79044142 TCCCTGCTGTGATTGTTCAAAGG + Intronic
992760448 5:79946970-79946992 GCGTTGCTGAGCTTGATGAGAGG + Intergenic
994001401 5:94784992-94785014 GCCATGCTGTACGTAATCAGTGG - Intronic
995705976 5:114989796-114989818 AGCCTGCTGGGCTTGATCGGGGG + Intergenic
996221402 5:120936961-120936983 TGCCTGCTGGGCTTGATCAGAGG + Intergenic
996679964 5:126221027-126221049 CACCTGCTGGGCTTGATCAGTGG + Intergenic
997621966 5:135305035-135305057 GCCCTGCTCTGCATCTTCAGTGG + Intronic
997651780 5:135527225-135527247 GCCCTGCTGTGTTTGGTGGGTGG + Intergenic
1002758257 6:181231-181253 GCCTTGCTGTGCTTGGTGAGAGG + Intergenic
1003683994 6:8282651-8282673 CGCCTGCTGGGCTTGATCGGAGG + Intergenic
1003907981 6:10720161-10720183 CCCCTGCTGGGCTTGATCGGAGG - Intergenic
1004811818 6:19270883-19270905 CGCCTGCTGGGCTTGATCAGGGG + Intergenic
1006038117 6:31229970-31229992 GACCTGCTGTGCTGGGGCAGAGG - Intergenic
1007542276 6:42658803-42658825 CCTCTGCTGTTCTTGATCATAGG + Exonic
1010124410 6:72415279-72415301 TCTCTGCTGTCCTTAATCAGTGG - Intergenic
1012338813 6:98092492-98092514 TCCCTGCTGTGCTCCATCACTGG + Intergenic
1013474234 6:110492901-110492923 GCCCTGCAGTTCTAGAGCAGAGG - Intergenic
1016182816 6:141168231-141168253 CGCCTGCTGGGCTTGATCAGGGG + Intergenic
1017624647 6:156336265-156336287 TAACTGCTGTGCTTGGTCAGAGG - Intergenic
1017782317 6:157725451-157725473 GCCCAGCTGTTCTGTATCAGTGG - Intronic
1018964650 6:168475179-168475201 GCCCTGCTGTGGGTGATCTGGGG + Intronic
1022101384 7:27171411-27171433 GCTGTGCTGTGTTTAATCAGGGG - Exonic
1022578003 7:31517571-31517593 CGCCTGCTGGGCTTGATCGGAGG - Intronic
1024005711 7:45223934-45223956 GCCCTGCTCTGCTTGGTCCCTGG - Intergenic
1027659747 7:80975015-80975037 TGCCTGCTGGGCTTGATCAGAGG - Intergenic
1029110081 7:98209441-98209463 TCCCTGCTGTGCTTTAACACAGG + Exonic
1031890997 7:127293513-127293535 GCCCTGATCTCCCTGATCAGGGG + Intergenic
1031893469 7:127322289-127322311 GCCCTGCTGTGCTGCATCTAAGG - Intergenic
1032386138 7:131525890-131525912 GCCCTGTGATGCTTGATGAGAGG + Intronic
1034897426 7:154886409-154886431 GCCCTTCTGTGCCTGGACAGAGG - Intronic
1038726703 8:30088257-30088279 CGCCTGCTGGGCTTGATCAGAGG + Intergenic
1038949162 8:32394866-32394888 GCCTTGCTGTGCTTCATTATAGG + Intronic
1043002084 8:74771847-74771869 CGCCTGCTGGGCTTGATCCGGGG - Intronic
1043150116 8:76704972-76704994 CCCATGCTGTGCATGATCATCGG + Exonic
1044302892 8:90606351-90606373 CGCCTCCTGAGCTTGATCAGTGG - Intergenic
1044327546 8:90876630-90876652 GCCTTTCTGTACTTAATCAGTGG - Intronic
1044457073 8:92401347-92401369 CAGCTGCTGGGCTTGATCAGGGG - Intergenic
1044457084 8:92401390-92401412 GGCCTGCTGGGCTTGATCAGGGG - Intergenic
1045106667 8:98899326-98899348 GGCCTACTGTGCTTGATGAATGG - Intronic
1045653428 8:104364026-104364048 GCCCTGCTGTGCTTGATCAGGGG - Intronic
1045964519 8:108009427-108009449 ACACTGCTGTGCATAATCAGTGG - Intronic
1046055209 8:109071051-109071073 CGCCTGCTGGGCTTGATCGGGGG - Intergenic
1047164494 8:122421880-122421902 CCCCTGCTGTACTTGGTCACTGG - Intergenic
1048388588 8:133937828-133937850 TCCCTGCTGAGCTTGGTCAATGG + Intergenic
1048703034 8:137115856-137115878 CGCCTGCTGGGCTTGATCAGGGG - Intergenic
1049196066 8:141316304-141316326 GCCCTACTGTGCCTGATCGTGGG - Intergenic
1050248869 9:3722263-3722285 GTGATGCTGTGTTTGATCAGTGG + Intergenic
1050898258 9:10911039-10911061 CGCCTGCTGGGCTTGATCGGAGG + Intergenic
1051968865 9:22863227-22863249 TGCCTGCTGGGCTTGATCGGAGG - Intergenic
1056872305 9:90293246-90293268 GCCCTGCTTGGCTGGGTCAGAGG + Intergenic
1057678773 9:97155662-97155684 GCTCTCCTGTGCTTCCTCAGTGG + Intergenic
1061602139 9:131677751-131677773 TCCCTGGTCTGCTTGAGCAGAGG - Intronic
1062412956 9:136433999-136434021 GCCCTGCAGTGCCTGCCCAGGGG - Intronic
1185447253 X:265563-265585 CTCCTGCTGTGTGTGATCAGAGG + Intergenic
1188066073 X:25661252-25661274 GTGCTGCTATGTTTGATCAGTGG + Intergenic
1197078977 X:122389114-122389136 CGCCTGCTGGGCTTGATCGGAGG - Intergenic
1199437469 X:147828768-147828790 GGCCTGCTGGGCTTGATCAGAGG - Intergenic
1201417907 Y:13766316-13766338 GCCTTTCTCTGCTTGATAAGAGG + Intergenic
1202090500 Y:21183527-21183549 CACCTGCTGGGCTTGATCAGGGG + Intergenic
1202242461 Y:22785699-22785721 CACCTGCTGGGCTTGATCAGAGG + Intergenic
1202395446 Y:24419448-24419470 CACCTGCTGGGCTTGATCAGAGG + Intergenic
1202475338 Y:25250644-25250666 CACCTGCTGGGCTTGATCAGAGG - Intergenic