ID: 1045653430

View in Genome Browser
Species Human (GRCh38)
Location 8:104364028-104364050
Sequence AAGCCCTGCTGTGCTTGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045653430_1045653432 -2 Left 1045653430 8:104364028-104364050 CCTGATCAAGCACAGCAGGGCTT 0: 1
1: 0
2: 1
3: 12
4: 142
Right 1045653432 8:104364049-104364071 TTGCGGAACCCCCGTCCACCTGG No data
1045653430_1045653442 25 Left 1045653430 8:104364028-104364050 CCTGATCAAGCACAGCAGGGCTT 0: 1
1: 0
2: 1
3: 12
4: 142
Right 1045653442 8:104364076-104364098 CACGCTGGCCGAGAGCGCCCAGG No data
1045653430_1045653437 10 Left 1045653430 8:104364028-104364050 CCTGATCAAGCACAGCAGGGCTT 0: 1
1: 0
2: 1
3: 12
4: 142
Right 1045653437 8:104364061-104364083 CGTCCACCTGGAACCCACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045653430 Original CRISPR AAGCCCTGCTGTGCTTGATC AGG (reversed) Intronic
900560557 1:3303862-3303884 AAGCCCTGGTGTGCATGCTGGGG + Intronic
900560600 1:3304034-3304056 AAGCCCTGGTGTGCATGCTGGGG + Intronic
901544795 1:9947943-9947965 AAGCCCTGCAGTGGTTGATGAGG + Intronic
902249849 1:15147131-15147153 AAGGCCTGCTGCATTTGATCAGG - Intergenic
904412906 1:30335773-30335795 AAGCTCTGCTGGGCCTAATCCGG + Intergenic
906360384 1:45152153-45152175 AAGCCATGCTGAACTTGAACAGG + Intronic
907153106 1:52306996-52307018 CAGGCCTGCTGGGCTTGTTCCGG - Intronic
907463319 1:54619011-54619033 GAGCCCTGCTTTGGTTGATTTGG + Intronic
907988683 1:59557691-59557713 AACCCCTGCTGTGTATTATCTGG - Intronic
910431319 1:87162174-87162196 TAGCCCTCCTCTTCTTGATCAGG - Intronic
911973949 1:104467863-104467885 AAGGCATGCTGTGGGTGATCAGG + Intergenic
918094260 1:181321708-181321730 CAGCCATGCTGTTCTTGGTCTGG - Intergenic
923018571 1:230145694-230145716 ACGTCCTGCTGTGCTGCATCAGG - Intronic
1063337770 10:5233072-5233094 AACCCATGCATTGCTTGATCTGG - Intergenic
1064861155 10:19827517-19827539 AAGCCCTGTGGTACTTGTTCTGG - Intronic
1068708117 10:60099926-60099948 AAGCTCTACTGTGCCTGATATGG + Intronic
1072959212 10:99914120-99914142 AAGCCCTGCTGTGATAGCCCGGG - Intronic
1076216565 10:128698235-128698257 AAGCCCTGCTGGGCCTGCTAAGG + Intergenic
1076235238 10:128858968-128858990 GAGCCCTGGTGTGCAGGATCTGG + Intergenic
1076235680 10:128862252-128862274 GAGCCCTGGTGTGCAGGATCTGG + Intergenic
1078515440 11:12018067-12018089 AAGCACTGCTGGGCCTGACCAGG - Intergenic
1083182260 11:60994581-60994603 AAGCCCTGCTGTGGTATAACTGG + Intronic
1085417664 11:76330059-76330081 AGGTTCTGCTGTGCTTGACCAGG - Intergenic
1087318852 11:96635911-96635933 AGCGCCTGCTGGGCTTGATCGGG + Intergenic
1088093528 11:106072693-106072715 AAGCTGTGCTCTGCCTGATCTGG + Intronic
1089027865 11:115290521-115290543 AAGCCCTGATGTATTTGATCAGG + Intronic
1094231569 12:28110500-28110522 AAGCCCAGCTCTTCTTTATCTGG + Intergenic
1097343348 12:58464858-58464880 AAGTCCTGCTTTGGTTGGTCAGG + Intergenic
1101824149 12:108207683-108207705 AGCCCCTGCTGTTCTTGATTAGG + Intronic
1104519393 12:129459029-129459051 GAGCCCTGATGTGCTTATTCTGG - Intronic
1105806157 13:23952858-23952880 AGCACCTGCTGGGCTTGATCGGG - Intergenic
1110794411 13:79620188-79620210 AATCCCTGCTATGCTGCATCAGG + Intergenic
1114793069 14:25681106-25681128 GACGCCTGCTGGGCTTGATCGGG - Intergenic
1115018493 14:28646014-28646036 GAGCCCTCCTGTGCTGGCTCAGG - Intergenic
1115284915 14:31705851-31705873 AGCACCTGCTGGGCTTGATCGGG - Intronic
1115285884 14:31712390-31712412 AGTGCCTGCTGGGCTTGATCAGG - Intronic
1116873791 14:50091838-50091860 AAGCTCTGCTGTGGAGGATCAGG - Intronic
1117532690 14:56674865-56674887 AAGCCCAGCTGTGCCTAACCTGG - Intronic
1117810218 14:59537443-59537465 AAGCCTTCCTGAACTTGATCAGG - Intronic
1124055038 15:26234552-26234574 CTGCCCTGCTGTGTTTCATCCGG + Intergenic
1125705992 15:41736670-41736692 AAGCCCAGATGTACTTGAACTGG - Exonic
1127785059 15:62348425-62348447 AAGCCCTGATCTGGTTGAGCTGG - Intergenic
1128356920 15:66934727-66934749 CAGCCCTGCTGGCCTTGATTTGG + Intergenic
1129393409 15:75231852-75231874 AAGCCCCTCTGTGTTTCATCTGG + Intergenic
1135338960 16:21630232-21630254 AGCGCCTGCTGGGCTTGATCGGG - Intronic
1136285021 16:29235692-29235714 AAGCCCTGCTGTGCCTCAGGAGG - Intergenic
1136519349 16:30786314-30786336 ATGCCCTGCTGTGTTTGCTCGGG + Intronic
1136748406 16:32612504-32612526 AAGCCCTCCTTTGCTGGACCAGG + Intergenic
1139330766 16:66188148-66188170 TAGTCCTGCAGTGCTTGCTCAGG + Intergenic
1140960633 16:79908851-79908873 AAGCCCTCCTGGGCCTCATCTGG - Intergenic
1142090085 16:88205316-88205338 AAGCCCTGCTGTGCCTCAGGAGG - Intergenic
1203050541 16_KI270728v1_random:871709-871731 AAGCCCTCCTTTGCTGGACCAGG + Intergenic
1142865978 17:2791790-2791812 AAGCTGGGCTGTGCTTGATGGGG + Intronic
1144389648 17:14781291-14781313 CAGCCCTGCTGTAGTTCATCTGG - Intergenic
1144511498 17:15881069-15881091 TAGCCTTGTTGTTCTTGATCTGG + Intergenic
1147839205 17:43358636-43358658 AAGCCCTGCTGTGGTTCAGCAGG - Intergenic
1148749135 17:49934757-49934779 CTGCCCTGCTCTGCTTGATGTGG + Intergenic
1153947546 18:10030961-10030983 AGGCTCTGCTGTGATTGGTCTGG + Intergenic
1157552319 18:48590283-48590305 AGGCCCTGCTGTCCTAGCTCTGG - Intronic
1158209740 18:55034854-55034876 AAGCATTGCTGATCTTGATCTGG + Intergenic
1161190421 19:2951747-2951769 AAGCCATCCTGGGCTTCATCCGG + Intergenic
1163498094 19:17658447-17658469 AAACCCTGCTTTGCTTTATGTGG + Intronic
925613178 2:5720460-5720482 TATCCGTGCTGTGCTTGATGAGG - Intergenic
928478460 2:31655479-31655501 AAACCATGATGTGCTTGCTCAGG - Intergenic
931412082 2:62042489-62042511 AGCACCTGCTGGGCTTGATCGGG - Intronic
932613789 2:73219181-73219203 AAGTCCTGCTGTGCTCCCTCAGG - Intronic
933797208 2:85929180-85929202 AGTGCCTGCTGGGCTTGATCAGG - Intergenic
934945490 2:98538163-98538185 AAGCCCTGCTGCCCTGGAGCCGG + Intronic
935715763 2:105937679-105937701 AACCCCAGCTCAGCTTGATCTGG - Intergenic
936044346 2:109174612-109174634 AAGCCTTGCTATGTTTGATAAGG + Intronic
936243250 2:110806165-110806187 AAGCCCTGCTTTACTTGCTTCGG + Intronic
936402354 2:112175145-112175167 AAGCCCTACTGTGCTTGACCAGG - Intronic
936450189 2:112628057-112628079 AGGCCATGCTGAGCTTGATGGGG + Intergenic
936941271 2:117886931-117886953 AAGCCCTGATCTGCAAGATCTGG + Intergenic
944688219 2:202136606-202136628 GACGCCTGCTGGGCTTGATCGGG - Intronic
946273867 2:218616053-218616075 AAGCCCAGCTGTGAGTGACCTGG + Exonic
947634209 2:231672016-231672038 TAGCGCTGCTGTGCTCCATCAGG - Intergenic
948184212 2:236006943-236006965 TAGCCCTGCAGTGCTTTTTCAGG + Intronic
1170606481 20:17878558-17878580 AAGCCCTGCAGTGCTGGCTGGGG + Intergenic
1171448716 20:25221900-25221922 CAGTCCTGCTGTGCCTGATGCGG - Intronic
1171982652 20:31638488-31638510 CAGGCCTGCTCTGCTGGATCTGG - Intronic
1173379806 20:42530012-42530034 AAGCCTTGCTGTGCTCTTTCAGG - Intronic
1173567616 20:44052841-44052863 CTGCCCTGCTGTGCCTGTTCAGG + Intronic
1175501019 20:59450821-59450843 AAGCCCTGGTGTGATTTCTCAGG + Intergenic
1176251281 20:64121546-64121568 AGGCTCTGATGTGCTTGGTCTGG + Intergenic
1179617970 21:42593905-42593927 AAGCCATGCTGTGGCTGACCAGG + Intergenic
1180245695 21:46545936-46545958 CAGGCCTGCTGGGCTTCATCGGG + Exonic
1180853618 22:19033485-19033507 AAGCCCAGCTGTGTGTGGTCAGG + Intergenic
1183022477 22:35038464-35038486 AACCCCTGCTGTTCTGGAACTGG - Intergenic
1184245536 22:43234096-43234118 AAGCCCAGCTGTGCTGGTCCAGG + Intronic
950809385 3:15636565-15636587 AAGCCCTGCTGTGCCTCAACAGG + Intronic
959161214 3:102726452-102726474 AAGCACTGCTTTGCTTGACTGGG + Intergenic
960518920 3:118632473-118632495 GAGCAGTGCTGTGCTGGATCTGG - Intergenic
961040208 3:123672926-123672948 ACTCCCTGCTGTGTTTGATTGGG - Intronic
962061860 3:131936397-131936419 AAGCCCTGCTGTACTAAATCTGG + Intronic
964449520 3:156798452-156798474 AAAGCCTACTGTGGTTGATCTGG - Intergenic
967282142 3:187833026-187833048 GGGCCCTGCTGTGCTGGAGCAGG + Intergenic
975033905 4:69658191-69658213 AGAGCCTGCTGGGCTTGATCAGG - Intergenic
977989829 4:103427793-103427815 AAGCCCTTCTTTGCTGGGTCTGG - Intergenic
979717292 4:123855606-123855628 AAGCCTTTCTGTGCTTGGTCAGG - Intergenic
984095495 4:175428055-175428077 AGCGCCTGCTGGGCTTGATCGGG + Intergenic
985322977 4:188735162-188735184 ATTGCCTGCTGGGCTTGATCAGG - Intergenic
985702199 5:1380419-1380441 GACGCCTGCTGGGCTTGATCTGG - Intergenic
988034419 5:25807569-25807591 AAGCCCTGCTGCACTGGATGGGG + Intergenic
992865040 5:80949669-80949691 AAGCTCTGCTGGGTTTGGTCTGG - Intergenic
995531474 5:113095894-113095916 AAGCCCTACTGAGCTTGCACTGG + Intronic
995705974 5:114989794-114989816 AAAGCCTGCTGGGCTTGATCGGG + Intergenic
995781604 5:115781777-115781799 AAGCCCTCCTGTGCTACATGTGG - Intergenic
998862422 5:146457708-146457730 AAGCCCTGCTGACCCTTATCTGG - Intronic
1001162342 5:169331708-169331730 AAGCCCTCCTCTGCTTGAATGGG + Intergenic
1002425350 5:179171648-179171670 ACTGCCTCCTGTGCTTGATCTGG + Intronic
1002468775 5:179422311-179422333 CAGCCCTGCTGGGCATGATTTGG + Intergenic
1002825075 6:765065-765087 AACCTCTGATGTGCTTGCTCAGG - Intergenic
1006103550 6:31702196-31702218 AAGCCCTGCTGTGTGTCCTCTGG + Intronic
1007516241 6:42413791-42413813 AAGCACTGCTGTGCTTGCGTTGG + Intronic
1015171642 6:130261052-130261074 AAGGCATGCTGTGGGTGATCAGG - Intronic
1016182814 6:141168229-141168251 AGCGCCTGCTGGGCTTGATCAGG + Intergenic
1016575548 6:145565902-145565924 AAGCACTGGTGTGCTTATTCAGG + Intronic
1016722034 6:147310165-147310187 AAGCACTGCTGTGCTAGAAATGG + Exonic
1018314008 6:162539007-162539029 CAGCCCTGCTGTAATTGACCTGG - Intronic
1018776634 6:167023247-167023269 AAGCCCTGAGGATCTTGATCTGG + Intronic
1018799777 6:167212923-167212945 AAGCCCTGTGGTGCTGGATGGGG + Intergenic
1018800726 6:167220149-167220171 AAGCCGTGCTGTGATTGGACAGG + Intergenic
1018964648 6:168475177-168475199 CAGCCCTGCTGTGGGTGATCTGG + Intronic
1021164536 7:17319856-17319878 AAACACTGCTGTGCTTTTTCAGG - Intronic
1022066542 7:26864525-26864547 TAGCCCCGCTGTTCTTAATCCGG - Exonic
1022718965 7:32925528-32925550 AAGCCATGCTGTGAGTGTTCTGG - Intergenic
1023226495 7:37975069-37975091 CAGCCCTGCTTTCCTTGTTCTGG - Intronic
1023726767 7:43150746-43150768 ATGCCCTGCTGTGCCTGTACTGG - Intronic
1027138491 7:75640366-75640388 AAGCCCTTCTGGGCTTGGGCTGG - Intronic
1027918651 7:84360542-84360564 AATCCTTGCTTTGCTAGATCTGG + Intronic
1029821770 7:103153245-103153267 AAGGCATGCTGTGGGTGATCAGG - Intergenic
1030102212 7:105956450-105956472 AAGCCCTGTTGTGCATGCTAAGG - Intronic
1032080455 7:128856076-128856098 GAGCCCTTCTGTGCTTCTTCTGG + Intronic
1032797949 7:135292483-135292505 ACCCCCTGCTGTCCTTTATCAGG - Intergenic
1036221049 8:6921917-6921939 GAGCACGGCTGTGCTTGCTCAGG + Intergenic
1037172632 8:15911502-15911524 GAGTCCTGCTGTCCTTGGTCAGG + Intergenic
1037582724 8:20255121-20255143 AAGCCCGGCAGTGCTTGCTGTGG + Exonic
1038953569 8:32443302-32443324 AACCTCTGCTGAGCTTTATCAGG + Intronic
1039877118 8:41596429-41596451 CAGCCATGCTGTGGGTGATCAGG + Intronic
1040694114 8:49975443-49975465 AAGCGCTGCTGTGCATGTTGTGG - Intronic
1041402855 8:57463123-57463145 AAGGCATGCTGTGGTTGATCAGG - Intergenic
1044457086 8:92401392-92401414 GGGGCCTGCTGGGCTTGATCAGG - Intergenic
1045372471 8:101538469-101538491 TAGCCTTGCTGTGATTGCTCTGG + Intronic
1045653430 8:104364028-104364050 AAGCCCTGCTGTGCTTGATCAGG - Intronic
1048369562 8:133765853-133765875 AAGTCCAGCTGTCCTTGAGCTGG - Intergenic
1049370848 8:142265492-142265514 AAGCCCTGCTGTGCCTCTGCAGG - Intronic
1051612251 9:18972632-18972654 ATGCCCTTCTGTGGCTGATCTGG - Intronic
1059503970 9:114781292-114781314 AAGCTCTGCTGTGGCTGCTCCGG - Intergenic
1186560199 X:10603568-10603590 ATGCCCAGATGTGCTTGATTTGG - Intronic
1188387627 X:29581035-29581057 CAGACCTGCTGTGCTTGCTCAGG - Intronic
1190006556 X:46745233-46745255 AAGCCCTGCTCTGCTCCATCTGG - Intronic
1192008317 X:67241060-67241082 GTTCCCTGCTGTGGTTGATCTGG - Intergenic
1197956487 X:131954927-131954949 AAGGGCAGCTGTGCTTCATCTGG - Intergenic
1199168149 X:144702061-144702083 AAGCACTGCTCTCCATGATCAGG + Intergenic
1200383546 X:155865480-155865502 AGTGCCTGCTGGGCTTGATCCGG + Intergenic