ID: 1045653437

View in Genome Browser
Species Human (GRCh38)
Location 8:104364061-104364083
Sequence CGTCCACCTGGAACCCACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045653425_1045653437 27 Left 1045653425 8:104364011-104364033 CCAGAGGGAGCTCATCCCCTGAT 0: 5
1: 19
2: 26
3: 49
4: 158
Right 1045653437 8:104364061-104364083 CGTCCACCTGGAACCCACGCTGG No data
1045653430_1045653437 10 Left 1045653430 8:104364028-104364050 CCTGATCAAGCACAGCAGGGCTT 0: 1
1: 0
2: 1
3: 12
4: 142
Right 1045653437 8:104364061-104364083 CGTCCACCTGGAACCCACGCTGG No data
1045653428_1045653437 12 Left 1045653428 8:104364026-104364048 CCCCTGATCAAGCACAGCAGGGC 0: 1
1: 0
2: 2
3: 43
4: 183
Right 1045653437 8:104364061-104364083 CGTCCACCTGGAACCCACGCTGG No data
1045653424_1045653437 28 Left 1045653424 8:104364010-104364032 CCCAGAGGGAGCTCATCCCCTGA 0: 5
1: 19
2: 29
3: 53
4: 183
Right 1045653437 8:104364061-104364083 CGTCCACCTGGAACCCACGCTGG No data
1045653429_1045653437 11 Left 1045653429 8:104364027-104364049 CCCTGATCAAGCACAGCAGGGCT 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1045653437 8:104364061-104364083 CGTCCACCTGGAACCCACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045653437 Original CRISPR CGTCCACCTGGAACCCACGC TGG Intronic
No off target data available for this crispr