ID: 1045653754

View in Genome Browser
Species Human (GRCh38)
Location 8:104366494-104366516
Sequence TATTGTGATCACACTGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045653753_1045653754 8 Left 1045653753 8:104366463-104366485 CCAGAGCAACGGACACTGAGCTA 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1045653754 8:104366494-104366516 TATTGTGATCACACTGTAGTTGG No data
1045653752_1045653754 12 Left 1045653752 8:104366459-104366481 CCTTCCAGAGCAACGGACACTGA 0: 1
1: 0
2: 1
3: 8
4: 113
Right 1045653754 8:104366494-104366516 TATTGTGATCACACTGTAGTTGG No data
1045653750_1045653754 20 Left 1045653750 8:104366451-104366473 CCAACTTTCCTTCCAGAGCAACG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 1045653754 8:104366494-104366516 TATTGTGATCACACTGTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045653754 Original CRISPR TATTGTGATCACACTGTAGT TGG Intronic
No off target data available for this crispr