ID: 1045656487

View in Genome Browser
Species Human (GRCh38)
Location 8:104392309-104392331
Sequence AACACCCTACAGTCTAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045656487_1045656496 21 Left 1045656487 8:104392309-104392331 CCTCCCCTAGACTGTAGGGTGTT 0: 1
1: 0
2: 0
3: 3
4: 101
Right 1045656496 8:104392353-104392375 TATCTCTTTCTTTTCTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045656487 Original CRISPR AACACCCTACAGTCTAGGGG AGG (reversed) Intronic
900277353 1:1839862-1839884 AACACACAACAGTCTGGGCGCGG + Intronic
902456303 1:16536096-16536118 AACACCTTACAATCCACGGGAGG - Intergenic
902495860 1:16871815-16871837 AACACCTTACAATCCACGGGAGG + Intronic
903706938 1:25292862-25292884 AACACCCTGCATTTTAGAGGGGG + Intronic
903720300 1:25400485-25400507 AACACCCTGCATTTTAGAGGGGG - Intronic
903921940 1:26805913-26805935 AACTCCCTGCAGTCCAGGGACGG - Intergenic
911377123 1:97064402-97064424 AGCACCCTACAGACCAAGGGAGG - Intergenic
914415476 1:147477467-147477489 AACATCCTAGAGTCCATGGGTGG - Intergenic
915526926 1:156481530-156481552 ACCACCCTACATTCTAGTGGAGG + Intronic
921575985 1:216835416-216835438 AACACTCTACAGTGTATGAGTGG + Intronic
924423554 1:243931237-243931259 CACACTCTCCAGTCTGGGGGTGG - Intergenic
1063280940 10:4628565-4628587 TGCACCCTGCAGGCTAGGGGTGG + Intergenic
1064449595 10:15429771-15429793 AACAAGCTACAGGCCAGGGGCGG - Intergenic
1072993680 10:100223957-100223979 TACAGCCTACATTCAAGGGGAGG - Intronic
1073778168 10:106808909-106808931 AACTCCCTCCACTCTAGAGGTGG + Intronic
1076273707 10:129178496-129178518 AACACCCAACAGTGTGGAGGGGG - Intergenic
1079015090 11:16862057-16862079 AACTCCCAACAGCCTGGGGGAGG + Intronic
1082762648 11:57142492-57142514 ATTATCCTACAGTCTAGGCGAGG + Intergenic
1084160345 11:67345504-67345526 AACATCCTGCAGTCAAGGGCAGG + Intronic
1084849852 11:71929796-71929818 AAGAGCCCACAGTCTAGTGGTGG + Intronic
1086873882 11:92072516-92072538 AACACACTACTATCTAGGAGGGG + Intergenic
1089386642 11:118072730-118072752 AACACCCTACAGTCTACTGAAGG - Intergenic
1096113441 12:49041755-49041777 AAAACACTACAGTATGGGGGCGG - Intronic
1104528047 12:129542945-129542967 TATACCATACAGTCTAGGTGTGG + Intronic
1126098749 15:45107151-45107173 TACACCCTACAGTCAAGAAGGGG - Intronic
1127825096 15:62696124-62696146 GAAACACTGCAGTCTAGGGGTGG - Intronic
1130826500 15:87552257-87552279 AACTCACTACAGCCTAGTGGTGG - Intergenic
1134246011 16:12540763-12540785 AGCACCTGACACTCTAGGGGAGG - Intronic
1135086745 16:19481147-19481169 AACACAATGCAGTCTAGTGGGGG - Intronic
1139500273 16:67357782-67357804 AACACCCTGCAATCAATGGGAGG - Intronic
1139925479 16:70483332-70483354 AACGCCCTGCAGTCAAGGGATGG - Intronic
1140776192 16:78250758-78250780 ACCTCCCTACAGTCCAGTGGTGG + Intronic
1140893047 16:79301209-79301231 GACACCCCACAGTCCTGGGGAGG + Intergenic
1148999927 17:51746964-51746986 AACACCCTCCAGTATAACGGGGG + Intronic
1158877315 18:61745635-61745657 ACCACCTTACAGTCCAGTGGAGG - Intergenic
1168398234 19:56066730-56066752 AACACCCTACAGCCCACAGGCGG - Intergenic
1168486551 19:56767522-56767544 AAGGCCCTCCAGTCTAGGAGGGG + Intergenic
1202707193 1_KI270713v1_random:32452-32474 AACACCTTACAATCCACGGGAGG - Intergenic
926752592 2:16210063-16210085 TAATCCCTACAGTGTAGGGGTGG - Intergenic
931037680 2:58261360-58261382 AACACCCTACAATGCATGGGAGG + Intergenic
933580724 2:84123912-84123934 AACACCATACAGCCTGGGGCGGG - Intergenic
943983494 2:194589239-194589261 AACATCATACAGTCTGGGTGCGG + Intergenic
1169408007 20:5341379-5341401 AACACCCAACAGACTAGGAATGG + Intergenic
1170356549 20:15497867-15497889 AAAAGCCCAAAGTCTAGGGGAGG - Intronic
1173180231 20:40800941-40800963 AAAATCATACAGTCTGGGGGTGG + Intergenic
1174238372 20:49112782-49112804 AAGAACCTTCAGTCTGGGGGAGG + Intergenic
1174534672 20:51241702-51241724 TACAGCCCACAGTCCAGGGGTGG - Intergenic
1181602217 22:23959408-23959430 AATACCCTTCAGTCTGGGAGTGG + Intronic
1181606292 22:23981899-23981921 AATACCCTTCAGTCTGGGAGTGG - Intronic
1182020972 22:27081170-27081192 AGCACCCTTCAGCCTAGGGCTGG + Intergenic
1185284814 22:49995464-49995486 AACACCCCACACTCTCGGAGGGG + Exonic
950150799 3:10685686-10685708 AGCACCCTATGGTCTAGTGGTGG + Intronic
952015241 3:28949001-28949023 ACCACCCTAGATTCAAGGGGAGG + Intergenic
953262895 3:41357436-41357458 AACACCCCACAGCCTAAGAGTGG + Intronic
959755689 3:109895809-109895831 AACAACCCACAGTTTAGTGGAGG - Intergenic
961254896 3:125541222-125541244 AAGAGCTTACAGTCTTGGGGAGG - Intronic
963056645 3:141191535-141191557 CACCCCTTACAGTCTAGGGAAGG - Intergenic
964247608 3:154671663-154671685 AGGACCCTACAGGCCAGGGGAGG - Intergenic
964348567 3:155780188-155780210 CACAACCTACACTCTAGGAGAGG + Intronic
965922726 3:173938709-173938731 AACACCCTCCAGATTAGAGGAGG + Intronic
967080290 3:186043504-186043526 AGCACCCAACAATCTAGTGGGGG - Intergenic
972503249 4:39697411-39697433 CCCACCCTACACTCTAGGGATGG + Intergenic
976041139 4:80886069-80886091 AACACCCCACGGACTAGTGGTGG + Intronic
977685868 4:99847161-99847183 AACACCTTACAGGCTAGCTGGGG + Intronic
979536892 4:121832050-121832072 AACAACCTACAGGCCAGGTGTGG + Intronic
985312533 4:188617662-188617684 AAGACCCTAAAGTGGAGGGGAGG + Intergenic
989979122 5:50621367-50621389 CACACCCTAGACTTTAGGGGTGG - Intergenic
997103875 5:130996199-130996221 AACATGCTACAGTCCAGGGACGG - Intergenic
998210570 5:140194219-140194241 CACAGCCTACAGTCTAGTGGAGG + Intronic
999981349 5:156960695-156960717 AACAATCTACAGGCCAGGGGTGG - Intronic
1000448076 5:161349500-161349522 TACAGCCTACACTCCAGGGGAGG - Intronic
1002297411 5:178239245-178239267 ACCTCCCTACAGACCAGGGGAGG - Intronic
1003532569 6:6949985-6950007 AACAACCCACAGTCTAGTAGGGG + Intergenic
1007969483 6:46036286-46036308 AAGACCTTGCAGTCTAGGTGGGG - Intronic
1012985936 6:105876469-105876491 AACAGCCTCAAGTCTAGAGGTGG + Intergenic
1013421597 6:109972134-109972156 AAAAGTCTACAGTCTTGGGGTGG + Intergenic
1015055726 6:128900859-128900881 AACACCCTCCTGTCTAGGCATGG + Intronic
1019969269 7:4527133-4527155 AAGAGCCTACATTCTAGTGGGGG + Intergenic
1022376566 7:29817915-29817937 AACACACTATAGTCTTGGGTAGG - Intronic
1023643831 7:42288530-42288552 AACAACCCACAGCCTAGTGGGGG + Intergenic
1023654893 7:42409482-42409504 AACCCTCTGCAGTGTAGGGGAGG + Intergenic
1025065364 7:55850179-55850201 AACACCTGACAGGCCAGGGGCGG + Intronic
1026368084 7:69670110-69670132 AAGAACATACAGTCTGGGGGTGG - Intronic
1032667354 7:134049901-134049923 AGGAGCCTACAGTCTAGGTGAGG + Intronic
1032805970 7:135354536-135354558 AAAAGCTTACAGTCTAGTGGAGG + Intergenic
1035134278 7:156685459-156685481 CACACCCTGCAGCCTAGGGATGG - Intronic
1039415706 8:37392274-37392296 ACGACACTACAGTCCAGGGGAGG - Intergenic
1039442683 8:37606019-37606041 AACAGCTTACAGTCTAGTTGAGG + Intergenic
1039744462 8:40411630-40411652 AACACCCAGCAGTCTATGAGGGG - Intergenic
1039778856 8:40763731-40763753 AACATCCTAGAGTCTAGATGGGG - Intronic
1041236573 8:55808798-55808820 ACCCCACTACAGGCTAGGGGTGG - Intronic
1045656487 8:104392309-104392331 AACACCCTACAGTCTAGGGGAGG - Intronic
1050729836 9:8696430-8696452 AAGTCCCTCCAGTCTTGGGGTGG + Intronic
1051963878 9:22802232-22802254 AACACCCTTAAGTCTACGAGTGG + Intergenic
1052159575 9:25240134-25240156 AAAAGCCTATAGTCTAGGGAGGG + Intergenic
1052804269 9:32998948-32998970 AACACCCAACATTTTAGGGAAGG + Intronic
1055277898 9:74640577-74640599 AAAAACCTACATTCTAGGGCTGG - Intronic
1056144767 9:83718716-83718738 AACACCTTACAGGCTGGGCGCGG - Intergenic
1060165816 9:121413707-121413729 AAGACCCTACAGTCTAGCAAGGG - Intergenic
1060777076 9:126382735-126382757 AACACCCCATAGTCTCTGGGGGG - Intronic
1189258389 X:39658499-39658521 AACACCCGGCAGTTGAGGGGTGG + Intergenic
1199018423 X:142847305-142847327 AACATCCTGCAGGCCAGGGGTGG - Intergenic
1199837348 X:151605092-151605114 AACACCTTACATTCTTGAGGGGG - Intronic
1200908322 Y:8508636-8508658 AACACTCTGCTGTCTTGGGGAGG - Intergenic
1201498784 Y:14618806-14618828 AATACCATACAGTTTAGAGGCGG + Intronic