ID: 1045656878

View in Genome Browser
Species Human (GRCh38)
Location 8:104396184-104396206
Sequence GTGTAGGAATGCAGCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 199}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045656878_1045656881 -3 Left 1045656878 8:104396184-104396206 CCTGGGCTGCTGCATTCCTACAC 0: 1
1: 0
2: 4
3: 24
4: 199
Right 1045656881 8:104396204-104396226 CACATCACAGTTATATTGATGGG No data
1045656878_1045656880 -4 Left 1045656878 8:104396184-104396206 CCTGGGCTGCTGCATTCCTACAC 0: 1
1: 0
2: 4
3: 24
4: 199
Right 1045656880 8:104396203-104396225 ACACATCACAGTTATATTGATGG No data
1045656878_1045656882 0 Left 1045656878 8:104396184-104396206 CCTGGGCTGCTGCATTCCTACAC 0: 1
1: 0
2: 4
3: 24
4: 199
Right 1045656882 8:104396207-104396229 ATCACAGTTATATTGATGGGAGG No data
1045656878_1045656883 1 Left 1045656878 8:104396184-104396206 CCTGGGCTGCTGCATTCCTACAC 0: 1
1: 0
2: 4
3: 24
4: 199
Right 1045656883 8:104396208-104396230 TCACAGTTATATTGATGGGAGGG No data
1045656878_1045656884 9 Left 1045656878 8:104396184-104396206 CCTGGGCTGCTGCATTCCTACAC 0: 1
1: 0
2: 4
3: 24
4: 199
Right 1045656884 8:104396216-104396238 ATATTGATGGGAGGGACTCTTGG No data
1045656878_1045656885 10 Left 1045656878 8:104396184-104396206 CCTGGGCTGCTGCATTCCTACAC 0: 1
1: 0
2: 4
3: 24
4: 199
Right 1045656885 8:104396217-104396239 TATTGATGGGAGGGACTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045656878 Original CRISPR GTGTAGGAATGCAGCAGCCC AGG (reversed) Intronic
900238670 1:1604523-1604545 GAGCAGGGATGCAGCAGCCCCGG + Intergenic
900631639 1:3639547-3639569 GTGGAGGGACACAGCAGCCCTGG - Intronic
902363555 1:15956002-15956024 GTCCAGGATTCCAGCAGCCCAGG + Intronic
902410269 1:16207983-16208005 GGGGCGGAATTCAGCAGCCCGGG - Exonic
903071783 1:20730400-20730422 GGGAGGGACTGCAGCAGCCCTGG - Intronic
904716877 1:32475051-32475073 GTGTGGCAAGGCAGCTGCCCTGG + Intronic
909054444 1:70805779-70805801 GTGTAGAAATGCAGCATCTCAGG - Intergenic
909214065 1:72863257-72863279 GTGTAGGATTTAAGCAACCCAGG - Intergenic
911154921 1:94627916-94627938 GTGGAGGCAGGCAGCAGCTCAGG - Intergenic
912439839 1:109689372-109689394 GTGCAGGAATGCAAGAGTCCTGG - Intronic
912443199 1:109714050-109714072 GTGCAGGAATGCAAGAGTCCTGG - Intronic
912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG + Intronic
912811201 1:112795904-112795926 GTGTCGGAATTCCGCAGGCCTGG - Intergenic
915204212 1:154257411-154257433 GGGTAGGCATGTAACAGCCCTGG - Exonic
915224354 1:154401739-154401761 GTGGAGGAATGCAGCATCCCTGG - Intergenic
916556595 1:165899186-165899208 GTGTTTGAGTGAAGCAGCCCTGG + Intronic
917222648 1:172748409-172748431 CTGTAAGCATGCAGCCGCCCGGG - Intergenic
917535329 1:175870481-175870503 GAGTAGGCCTCCAGCAGCCCTGG + Intergenic
920554608 1:206895551-206895573 GTCTAGGATTTCAGCTGCCCTGG + Intergenic
920678658 1:208056487-208056509 GTGTAGGAAAGGAGAAGGCCTGG + Intronic
920850783 1:209626773-209626795 GTGTAGGTCTGCAGCAGGGCAGG - Intronic
922938535 1:229439917-229439939 GTCAAGGATTGCAGCAGACCTGG - Intergenic
1066106581 10:32162200-32162222 GTGTGGGATTTCAGCAGCTCTGG + Intergenic
1067796147 10:49323595-49323617 GTGCAGGGATCCAGGAGCCCAGG + Exonic
1068811413 10:61259559-61259581 TTTTAGAAATGCAGCAGCTCAGG + Intergenic
1069738784 10:70674379-70674401 GTGTAGGAATCCTGGAGCTCAGG + Intronic
1069747710 10:70726387-70726409 GTGGAGGAAGGCAGCAGCCCTGG + Intronic
1069802900 10:71093349-71093371 AGGCAGGAAAGCAGCAGCCCTGG - Intergenic
1073104393 10:101023927-101023949 GTGGAGGAAGGCAGCAGTGCAGG - Exonic
1074320323 10:112395951-112395973 GTGGTGGAATGCAGCAGGACGGG - Intronic
1075127987 10:119715982-119716004 CTGCAGGCAGGCAGCAGCCCCGG + Intergenic
1076498685 10:130917083-130917105 GCCAAGGAATGCAGCAGCCATGG + Intergenic
1076757820 10:132582913-132582935 ATGTCGGAATGCAACAGGCCTGG - Intronic
1078518574 11:12045615-12045637 GTGGAGGATTGCTGGAGCCCAGG + Intergenic
1079236975 11:18698277-18698299 ATATAGGTATGCAGCAGCCATGG - Intronic
1083475104 11:62910283-62910305 CTGTAGGCCTGCAGCAGCCTGGG + Exonic
1083896046 11:65620335-65620357 GTGTAGGAACGCCGCACACCTGG - Exonic
1084128211 11:67115110-67115132 GTGGAGGATTGCTGGAGCCCAGG - Intergenic
1084170431 11:67398341-67398363 GTGCAGGCAGGAAGCAGCCCTGG + Exonic
1087200333 11:95338484-95338506 GGGTGGGAAAGCAGCTGCCCTGG - Intergenic
1087314690 11:96590223-96590245 GCCAAGGAATGCCGCAGCCCGGG + Intergenic
1088707855 11:112479969-112479991 TTCTAGAAATGCAGAAGCCCAGG - Intergenic
1089650497 11:119909798-119909820 GTGCAGCACTGCAGCAGCCTAGG - Intergenic
1089827342 11:121290767-121290789 ATGTAGGAATGCTGCACCCCAGG + Intergenic
1090034816 11:123239607-123239629 CTATAGGAATTCAACAGCCCAGG - Intergenic
1090408851 11:126493817-126493839 AAGTAGGAATGAAGCAGCTCTGG - Intronic
1090549322 11:127802446-127802468 GTGGAGGATTGCTGGAGCCCAGG + Intergenic
1091115044 11:133004978-133005000 GAGTAAGAGTGCAGCAGTCCAGG - Intronic
1091821888 12:3481540-3481562 GTACTGGGATGCAGCAGCCCTGG + Intronic
1092405067 12:8215735-8215757 CTGTGGGAATTCAACAGCCCTGG - Intergenic
1094805055 12:34082726-34082748 TGGAAGGAATGCAGGAGCCCAGG + Intergenic
1094826970 12:34276859-34276881 CTGTAGGAATGCTTGAGCCCAGG + Intergenic
1100960198 12:99954756-99954778 TTGTAGGATTGCAGCATCCCTGG - Intronic
1102963233 12:117107251-117107273 AGGTAGAAATGCAACAGCCCTGG + Intergenic
1103858131 12:123989040-123989062 GTCTGGGAAGGCAGAAGCCCAGG - Intronic
1103938042 12:124486784-124486806 GTGTGGGAAGGATGCAGCCCAGG - Intronic
1105410644 13:20168534-20168556 GATTAGGAATCCAGCAGCCCAGG + Intergenic
1105722955 13:23134836-23134858 GAGTGGGGATGCAGCAGTCCAGG - Intergenic
1106343935 13:28857987-28858009 GTGTACGATTGCAACAGCACTGG + Intronic
1108029354 13:46212404-46212426 GAGTTGGGATCCAGCAGCCCTGG + Intronic
1108977991 13:56473520-56473542 GTCTAGGAATACAGCTACCCAGG - Intergenic
1109262527 13:60161017-60161039 GTGTAAGAAAGCAGGAGCTCTGG - Intronic
1109613522 13:64798372-64798394 CTGGAGGTATGCACCAGCCCTGG - Intergenic
1115771390 14:36666494-36666516 GTGGAGGAGTGGAGCAGCCTGGG + Exonic
1117277810 14:54207257-54207279 GTGAAGGATTGCTGGAGCCCAGG - Intergenic
1121006816 14:90496005-90496027 GTGCTGGGATTCAGCAGCCCAGG + Intergenic
1122576481 14:102746201-102746223 GTAGATGACTGCAGCAGCCCTGG + Intergenic
1124214740 15:27797070-27797092 GTGAAGGGAGGCAGCAGCGCAGG - Intronic
1125255774 15:37761033-37761055 GTGTAGGGTTTGAGCAGCCCAGG - Intergenic
1126612210 15:50541028-50541050 GGGTAGGAATGCAGTATTCCTGG - Exonic
1127931087 15:63597964-63597986 GTGTTTGCATGAAGCAGCCCAGG - Intronic
1129162634 15:73755105-73755127 GGGTGGGAATCCAGCTGCCCTGG + Intergenic
1131106355 15:89737412-89737434 GTGCAGGTCTCCAGCAGCCCTGG + Intronic
1132777242 16:1601738-1601760 GTGCTGGAAGGCAGCAGCCAGGG + Intronic
1133248372 16:4464092-4464114 TTCTAGGAATGCAGCAACCCAGG - Intronic
1134275185 16:12769669-12769691 GTGAAGGAGTGCAGGAGCCAGGG + Intronic
1134669992 16:16047763-16047785 GCGTAGAAATGCAGAATCCCAGG + Intronic
1134834008 16:17346378-17346400 GTGAATGAACGCAGCAGGCCAGG + Intronic
1135111361 16:19693006-19693028 TTGCAGAAATGCTGCAGCCCTGG + Intronic
1137249656 16:46732441-46732463 CTGCAGGAGAGCAGCAGCCCCGG - Exonic
1137587018 16:49669777-49669799 GAGTAGGGAAGCAGGAGCCCTGG - Intronic
1138396644 16:56709656-56709678 CTGTAGGTGTGCTGCAGCCCAGG - Intronic
1139309703 16:66018123-66018145 GTGTGGAGTTGCAGCAGCCCTGG - Intergenic
1141522203 16:84588151-84588173 GTGTAGGAATGCTTGAGTCCAGG + Intronic
1143110037 17:4547991-4548013 GTGCTGGAAGGCAGCAGCCCTGG + Exonic
1144214854 17:13046470-13046492 GTGTCTGAATGCAGAAGCTCAGG + Intergenic
1144262354 17:13534633-13534655 TGGTAGGATTGCTGCAGCCCAGG + Intronic
1144632646 17:16881906-16881928 GTGTGGGATTGCTGCAGCCCTGG - Intergenic
1146939062 17:36831335-36831357 GGGCAGGAATGCAGCTGGCCTGG - Intergenic
1147671480 17:42179348-42179370 GTGGAGGGTTGCAGGAGCCCAGG - Intronic
1148966573 17:51440897-51440919 GTGGAGGTTTGCAGCACCCCAGG + Intergenic
1151810124 17:76434944-76434966 GTGTAGGAATCCATGATCCCTGG - Intronic
1151909002 17:77069105-77069127 CTGTTGGGATGCAGCAGGCCGGG - Intergenic
1152556794 17:81057271-81057293 GTGGAGGAGTTCAGCAGGCCCGG + Intronic
1153649605 18:7228439-7228461 GTGTAGGAATGAGGGAGCACAGG - Intergenic
1155183485 18:23368154-23368176 ATGTCAGAATGTAGCAGCCCAGG + Intronic
1157511094 18:48275319-48275341 GCATAGGAACGCAGCAGCGCTGG - Intronic
1157612633 18:48967925-48967947 GTGTAGGATTGCTTGAGCCCTGG - Intergenic
1159697854 18:71583374-71583396 CTATGGGAATGCAGCAGCCTGGG + Intergenic
1162141832 19:8589802-8589824 GTGGATGAATGCAGCATCCCGGG - Intronic
1163486172 19:17587720-17587742 GGGGAGGATTGCTGCAGCCCAGG - Intergenic
1164015254 19:21250710-21250732 ATCTAGGAATGCAGCAAACCAGG + Intronic
1164435418 19:28224391-28224413 TTGGAGGGATGCAGAAGCCCTGG - Intergenic
1167828505 19:51997579-51997601 GTGTAGGGATGGAATAGCCCAGG - Intronic
1167958812 19:53089919-53089941 TTGTAGGAATGGAGCAGAACAGG - Intronic
927735048 2:25512822-25512844 GGGTAGGAAGGCAGCAGGTCTGG + Intronic
929818644 2:45256598-45256620 GTCTACAAATGCAGCAGCGCAGG + Intergenic
935044650 2:99469579-99469601 GTGTAGGCATTCAGGATCCCTGG - Intronic
935185528 2:100728726-100728748 CTGTAGGCATGCACCACCCCTGG + Intergenic
937500369 2:122471932-122471954 GTCAAGGAAAGCAGCTGCCCTGG - Intergenic
938313942 2:130313842-130313864 CTGCAGGCATGCAGGAGCCCAGG - Intergenic
940131737 2:150389511-150389533 CAGCAGGAATGCAGCATCCCAGG + Intergenic
941096772 2:161245910-161245932 GAGGAGAACTGCAGCAGCCCAGG - Intergenic
942470088 2:176251018-176251040 GTGGAGGAATGCAGCACCCAGGG - Intergenic
943242443 2:185402796-185402818 GTGTAGAAATACATCAGCACAGG + Intergenic
943986977 2:194635402-194635424 GTCTGGGAATGCAGGAGCCAGGG - Intergenic
944417670 2:199495276-199495298 GTGGGGGATTGCAGGAGCCCGGG - Intergenic
945464865 2:210157465-210157487 GTGAAGGATTGCTGGAGCCCTGG + Intronic
945875248 2:215271689-215271711 CTGGAGGAATGAAGCAGCCCAGG + Intergenic
946176710 2:217926858-217926880 GTGTTTGAATCCAGCAGACCTGG - Intronic
946286585 2:218708399-218708421 GTGGAGGACTGCTTCAGCCCAGG + Intergenic
948589448 2:239039798-239039820 GTAGGGGAATGCAGGAGCCCAGG + Intergenic
948863761 2:240765276-240765298 GTCTCTGAATGCAGCACCCCGGG - Intronic
948988664 2:241541134-241541156 GCCAAGGAAAGCAGCAGCCCCGG + Intergenic
1168918126 20:1508315-1508337 GTCTTGGAAGGCAACAGCCCCGG - Intergenic
1169445292 20:5666342-5666364 GTGGGGAAATGCAACAGCCCAGG - Intergenic
1172973408 20:38889526-38889548 GTGCAGGCATGCAGGGGCCCGGG - Intronic
1173217248 20:41096569-41096591 GTTTAGAAATGCAGAATCCCAGG - Intronic
1176082603 20:63281527-63281549 CTGCAGGAACACAGCAGCCCAGG + Intronic
1177734345 21:25070252-25070274 GGACAGTAATGCAGCAGCCCTGG + Intergenic
1178439067 21:32584042-32584064 CTGTAGGAATGCACCACCCCGGG - Intronic
1179020098 21:37632014-37632036 GTAAAACAATGCAGCAGCCCAGG + Intronic
1179388508 21:40965795-40965817 ATATAGGAATGCAGAAGCTCAGG - Intergenic
1179525404 21:41972920-41972942 GAGTAGGAATGCAGTAGGCCGGG - Intergenic
1180047633 21:45317174-45317196 CTGTAGGAATGCAGGTGCCCTGG + Intergenic
1180595714 22:16971882-16971904 GAGAAGGAATGCAGAGGCCCAGG - Intronic
1180781408 22:18522022-18522044 GTGGAGGATTGCGGGAGCCCGGG - Intergenic
1181238292 22:21461365-21461387 GTGGAGGATTGCGGGAGCCCGGG - Intergenic
1182280987 22:29217580-29217602 GTGTGTGCCTGCAGCAGCCCCGG + Intronic
1183095125 22:35547379-35547401 GAGAAGGAAAGCAGCAGCCAGGG - Intronic
1183162454 22:36123949-36123971 GTTCAGGAATCCAGCAGCGCCGG - Intergenic
1183784747 22:40022865-40022887 GTGCAGGAATGCAGGAGTCCTGG - Intronic
949898452 3:8790096-8790118 GTGGAGGAATGCTTGAGCCCAGG + Intronic
951643270 3:24859805-24859827 TTGTAGCAATAAAGCAGCCCTGG + Intergenic
953424510 3:42782325-42782347 CTGTGGGAATGCAGTAGCACAGG - Intronic
953463761 3:43102246-43102268 GTGTGGCAATACAGCAGACCAGG + Intronic
954415028 3:50389127-50389149 GTGCAAGAAGGCTGCAGCCCCGG + Intronic
955049549 3:55396749-55396771 GTGGAGGAAAGCAGCAGCCCAGG + Intergenic
955397186 3:58565915-58565937 GTGCAGGAATGCGGCAGCCCTGG + Exonic
957988399 3:87599304-87599326 TTGTAGGAATGCAGATGCTCAGG + Intergenic
961506396 3:127373161-127373183 GTGTATGAGTGCAGCAAGCCAGG + Intergenic
963776788 3:149448055-149448077 GTCTAGGAAAGCAGGAGCCCAGG + Intergenic
965900586 3:173636214-173636236 GTGCAGGGATGCAGCAGCGGTGG - Intronic
966700257 3:182841681-182841703 GTGTAAGAATGGTGCAGGCCGGG + Intronic
966897668 3:184457831-184457853 GTGAAGGAAGGGAGGAGCCCAGG - Intronic
972794272 4:42399798-42399820 GTGTATGAATGCTGGAGCGCAGG + Intronic
974581593 4:63810585-63810607 ATGTAGGAATGCAGCTAACCAGG - Intergenic
975552160 4:75624456-75624478 GTGTAGGATTGCTTGAGCCCAGG + Intronic
976764778 4:88588831-88588853 AGGTAGAAGTGCAGCAGCCCTGG + Intronic
979468355 4:121067906-121067928 GTTTAGGAAGGAAGCAGCCAAGG + Intronic
980283139 4:130747319-130747341 GTGAAGGAAAGAAGCAGCTCAGG + Intergenic
980867093 4:138564576-138564598 TTGGAGGAATGCAGCAGTGCTGG + Intergenic
981704223 4:147642030-147642052 GAGCAGGAATGCAGGAGCCTAGG - Intronic
984933624 4:184870305-184870327 GTGTAGGAAAGCAGGATTCCTGG - Intergenic
985344971 4:188994573-188994595 GTGTAGGAAAACAGGAACCCGGG - Intergenic
992014328 5:72560333-72560355 AGGTAGGAATGCAGCAGCTAAGG + Intergenic
996117352 5:119633342-119633364 GTGTAGGAGAGCATGAGCCCTGG + Intronic
996896507 5:128489943-128489965 ATGTAGGAATGAGGCAGACCTGG + Intronic
997853583 5:137354236-137354258 GTATAGGAATGCAGGAGACTAGG - Intronic
998405801 5:141874160-141874182 GTCAAGGAATGAACCAGCCCAGG + Intronic
999428498 5:151506769-151506791 GTGTGGAAGTGCAGCAGCCTTGG - Intronic
1001564153 5:172688777-172688799 GTTTGAGAATCCAGCAGCCCTGG + Exonic
1001888225 5:175315544-175315566 GAGTGGAGATGCAGCAGCCCCGG + Intergenic
1004156786 6:13176052-13176074 GGGTAGGCAAGCAGAAGCCCTGG + Intronic
1005772829 6:29093068-29093090 ATGTAGCAATGCTGCACCCCTGG - Intergenic
1007291973 6:40794479-40794501 ATTTGGAAATGCAGCAGCCCTGG + Intergenic
1011668810 6:89662465-89662487 GTGTAACACTGCAACAGCCCAGG - Intronic
1011829563 6:91355067-91355089 GTGCAGGAATTCAGGAGCCATGG + Intergenic
1012310940 6:97723250-97723272 GTGTATGAATGGAGAAGCCATGG + Intergenic
1012421396 6:99069897-99069919 GAGGAGGAATGCATGAGCCCAGG - Intergenic
1015123155 6:129722994-129723016 GTGTAGAAATTAAGCATCCCTGG - Intergenic
1016272041 6:142301428-142301450 GTGAAGCAAAGCAACAGCCCGGG + Intergenic
1016720911 6:147296103-147296125 ATGTAGTACTGCAGCAGCCCAGG - Intronic
1017732552 6:157330312-157330334 GTGCTGGAATCCAGCAGCCCTGG + Intergenic
1019410310 7:903888-903910 GTGCAGGAAGGCAGCTTCCCAGG - Intronic
1019839145 7:3421833-3421855 AGGAAGGAAGGCAGCAGCCCTGG - Intronic
1019932424 7:4233154-4233176 GGGTCGGCTTGCAGCAGCCCTGG - Intronic
1020125973 7:5532647-5532669 GGCCAGGAATGCTGCAGCCCGGG - Intronic
1022265160 7:28746448-28746470 CTTTAGGAATGCAGAATCCCTGG + Intronic
1022475122 7:30705003-30705025 GTGGGCGAATGCAGCAGCCCAGG + Intronic
1023120690 7:36905339-36905361 GTGCAAGAAAGCAGCACCCCAGG - Intronic
1029443609 7:100601191-100601213 GTGCAGGAGGGCAGGAGCCCAGG + Intergenic
1030928387 7:115487150-115487172 GAGTAGGAAAGCAGCAGCAATGG + Intergenic
1031124895 7:117762538-117762560 GTGTAGGAATGCAGCAGATGAGG - Intronic
1033597559 7:142868028-142868050 CTGCAGCAATACAGCAGCCCAGG + Exonic
1034469728 7:151248773-151248795 GTGCAGGAATGCGGCAGCCGCGG - Exonic
1035833362 8:2722619-2722641 GTGGATGAGTGCAGCAGCCAAGG + Intergenic
1038032487 8:23654829-23654851 GTGTCGGAAAACAGCAGGCCTGG + Intergenic
1038704683 8:29882604-29882626 GCCTGGGAATCCAGCAGCCCTGG + Intergenic
1045656878 8:104396184-104396206 GTGTAGGAATGCAGCAGCCCAGG - Intronic
1045747725 8:105442693-105442715 GAGTAGGAATGTAGAAACCCAGG - Intronic
1048060858 8:130917954-130917976 GTGAAGCACTGCAGCAGGCCAGG - Intronic
1049542520 8:143215009-143215031 GTGTAGCACCGCAGCAGCACTGG - Intergenic
1055285770 9:74726698-74726720 GGGTAGGAATGAATCAGACCTGG + Intronic
1055483047 9:76728715-76728737 GCTTTGGAATACAGCAGCCCAGG + Intronic
1056560597 9:87726248-87726270 GAGTAGGTGTGCACCAGCCCTGG + Exonic
1056603388 9:88064534-88064556 GTGGAGGTAGACAGCAGCCCTGG - Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1057819184 9:98318225-98318247 GCTTAGAAATGCAGCATCCCAGG - Intronic
1058263719 9:102872064-102872086 GTGTAGGCATGCAGCAGGCAGGG - Intergenic
1060521815 9:124298296-124298318 TTCTAGGAAAGCAGCAGCCACGG - Intronic
1061052003 9:128202382-128202404 GGGTAGGATTGTAGGAGCCCTGG + Intronic
1061506452 9:131034347-131034369 GTTTAGGCAGGCAGCACCCCAGG - Intronic
1061909916 9:133717025-133717047 GTCTAGGGATGAAGAAGCCCAGG + Intronic
1062042869 9:134412146-134412168 GTGAGGCATTGCAGCAGCCCTGG + Intronic
1062186970 9:135223443-135223465 GGGTAGGAAAGCAGGGGCCCTGG + Intergenic
1203441700 Un_GL000219v1:15653-15675 GTGCAGGGAAGCAGCAGCTCTGG + Intergenic
1203512510 Un_KI270741v1:134562-134584 GTGCAGGGAAGCAGCAGCTCTGG + Intergenic
1186293718 X:8125900-8125922 TTGCAGGAATGCAGGAGCCCAGG - Intergenic
1189335560 X:40168769-40168791 GCCTACGAAAGCAGCAGCCCAGG + Intronic
1190432177 X:50388601-50388623 GTGTTGGATGGCAGCAGCCTAGG + Exonic
1194850737 X:98865386-98865408 GTGTAGGGATGCAAGACCCCGGG + Intergenic
1194872203 X:99146475-99146497 GAGTAGGATTGCAGGAGTCCAGG - Intergenic
1195382285 X:104282198-104282220 GTGAAGAAATGCAACTGCCCCGG - Intergenic
1196098802 X:111827480-111827502 GAGTAGGAAAGGAGCAGGCCTGG - Intronic
1198989468 X:142494877-142494899 GATTAGAAATGCAGCAGCCAGGG - Intergenic
1200037732 X:153344318-153344340 GGGTAGGAAGGCAGCAGCTGGGG - Intronic
1201403130 Y:13624638-13624660 GTGTAGGAGTGTAGAAGCCAAGG - Intergenic