ID: 1045663056

View in Genome Browser
Species Human (GRCh38)
Location 8:104457994-104458016
Sequence GTCCAGTGGGAAGACGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 209}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045663056_1045663066 25 Left 1045663056 8:104457994-104458016 CCACCTTCGTCTTCCCACTGGAC 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1045663066 8:104458042-104458064 AGGGAAAACAGAAAGGAAGAGGG No data
1045663056_1045663065 24 Left 1045663056 8:104457994-104458016 CCACCTTCGTCTTCCCACTGGAC 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1045663065 8:104458041-104458063 GAGGGAAAACAGAAAGGAAGAGG No data
1045663056_1045663061 2 Left 1045663056 8:104457994-104458016 CCACCTTCGTCTTCCCACTGGAC 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1045663061 8:104458019-104458041 GCACAGTGAAGAAATGAGAAGGG No data
1045663056_1045663064 18 Left 1045663056 8:104457994-104458016 CCACCTTCGTCTTCCCACTGGAC 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1045663064 8:104458035-104458057 AGAAGGGAGGGAAAACAGAAAGG No data
1045663056_1045663060 1 Left 1045663056 8:104457994-104458016 CCACCTTCGTCTTCCCACTGGAC 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1045663060 8:104458018-104458040 AGCACAGTGAAGAAATGAGAAGG No data
1045663056_1045663062 5 Left 1045663056 8:104457994-104458016 CCACCTTCGTCTTCCCACTGGAC 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1045663062 8:104458022-104458044 CAGTGAAGAAATGAGAAGGGAGG No data
1045663056_1045663063 6 Left 1045663056 8:104457994-104458016 CCACCTTCGTCTTCCCACTGGAC 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1045663063 8:104458023-104458045 AGTGAAGAAATGAGAAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045663056 Original CRISPR GTCCAGTGGGAAGACGAAGG TGG (reversed) Intronic
901036453 1:6338881-6338903 GCCCAGTGGGAAGGGGAAGGGGG + Intronic
901143342 1:7049965-7049987 GCCCAGTGGGAAAGTGAAGGAGG + Intronic
901817041 1:11800289-11800311 GACCAGTGGGAAGAGGAGGAGGG - Exonic
903085793 1:20857473-20857495 GTCCAGAGAGTGGACGAAGGTGG - Exonic
904377329 1:30090104-30090126 GTCCAGTGAGGAGATGGAGGGGG + Intergenic
906289874 1:44612900-44612922 AACCAGTGGGAAGAAGAAGAAGG + Intronic
908315413 1:62927689-62927711 CCCAAGTGGGAAGACGAAAGTGG + Intergenic
908328744 1:63049599-63049621 GTCCTGTGGGAAGAGGGATGTGG + Intergenic
910894433 1:92053275-92053297 GCCCTGTGGGAAGATGGAGGAGG + Intronic
913335597 1:117706760-117706782 GTCCAGTTGGCAGATGATGGTGG - Intergenic
914391121 1:147224170-147224192 GTTCACTAGGAAGACAAAGGAGG + Intronic
914428807 1:147601033-147601055 GTCCAGAGGGAAGGAGAGGGAGG + Intronic
915108347 1:153547919-153547941 GTCCACTTGGGAGAGGAAGGAGG - Intronic
916247340 1:162701979-162702001 CTCCAGTGGGAAGAGAAAAGTGG - Intronic
916730003 1:167557584-167557606 GAGCATTGGGAATACGAAGGCGG - Intergenic
918184370 1:182114031-182114053 GTCCTGTGGGAGGACCTAGGTGG + Intergenic
918647474 1:186920148-186920170 GTCCCCTGGGAAGAAGAAAGGGG - Intronic
920075875 1:203336157-203336179 GTCCAGGGAGCAGAAGAAGGGGG - Intergenic
921882625 1:220272116-220272138 GTCCAGAGGGCAGAGGCAGGAGG + Intronic
922758509 1:228109693-228109715 GTCCTGAGGGAGGACGCAGGGGG + Intergenic
1062829156 10:593771-593793 GTCCAGAGGGGAGACGGATGTGG - Intronic
1063109885 10:3026368-3026390 GGCCAGTGGGAGGAGGAATGGGG - Intergenic
1063131521 10:3181954-3181976 CTGAAGTGGGAAGAGGAAGGAGG + Intergenic
1063515036 10:6687429-6687451 GTACAGTGGGAGGAAGAAGAGGG - Intergenic
1066063497 10:31745072-31745094 ATCCAGTGGGAAGGAGCAGGTGG - Intergenic
1067170645 10:43903470-43903492 GGCCAGTAGGAAGAGGAAGCTGG + Intergenic
1069983815 10:72270595-72270617 GTCTAGTGGGAAGACCAAAGTGG + Intergenic
1070777498 10:79118407-79118429 GTCCTGTGGGAAGCGGGAGGAGG + Intronic
1071093634 10:81948608-81948630 GTACAGTGGGAAGATGCTGGAGG + Intronic
1073758678 10:106607781-106607803 CTCCAGTGGGCTGACGAAGGAGG - Intronic
1075871120 10:125773454-125773476 GTCCAATTGTAAGACGGAGGTGG + Intronic
1077877757 11:6321885-6321907 GTTCAGTGAGAAGAGGAAGAGGG - Intergenic
1077907787 11:6547257-6547279 GTCCACTGGGGAGACTAAGCTGG - Exonic
1079840762 11:25396620-25396642 GTTGAGTGGGAAGACTAATGTGG + Intergenic
1081941169 11:46943559-46943581 GTCCAGTGGCAAGAAGAAATTGG - Intronic
1083472218 11:62891498-62891520 GTCCAGGAGGCAGAGGAAGGAGG - Intergenic
1084668620 11:70592204-70592226 GTGCAGAGGGAAGACGGAGCAGG - Intronic
1084773656 11:71360897-71360919 GGCCAGGGGAAAGAGGAAGGGGG + Intergenic
1084945148 11:72634312-72634334 GGCCTGTGGGAAGAGGAAGACGG + Intronic
1088741394 11:112770297-112770319 TTCCAGTGGGAAAGGGAAGGGGG - Intergenic
1089502470 11:118940574-118940596 AACCTGAGGGAAGACGAAGGAGG - Intronic
1089905760 11:122036686-122036708 GTGCAGTGGGAACACGGAGTAGG + Intergenic
1090446631 11:126770125-126770147 GTCCAGTGGGAAGCCTGAGTTGG + Intronic
1090479260 11:127053693-127053715 GTGCAGTGGCTAGAAGAAGGGGG + Intergenic
1090925996 11:131250987-131251009 TTCCAGTGAGCAGAGGAAGGTGG + Intergenic
1091741518 12:2963285-2963307 TTCCACTGGGAAGGAGAAGGAGG - Intronic
1092889284 12:12953608-12953630 AGCCAGTGGGAAAACCAAGGAGG - Intergenic
1094059658 12:26300264-26300286 GACCAGAGAGAAGAGGAAGGAGG - Intergenic
1095347195 12:41164977-41164999 GTCCTGTGGTAAGGCAAAGGAGG - Intergenic
1097482308 12:60144317-60144339 GTCCAGTGGGAAGTCAGAGGTGG + Intergenic
1102887425 12:116532700-116532722 GTCCAGGAGGAAGATGCAGGTGG + Intergenic
1104161134 12:126182034-126182056 GGCGAGTGGGAAGATCAAGGTGG + Intergenic
1104571510 12:129929986-129930008 GTGCATTGGGAAGAGGAAGGTGG - Intergenic
1104838918 12:131811131-131811153 GTCCAAGGGGAAGACAGAGGTGG - Intergenic
1111930219 13:94504903-94504925 GTCCAATGAGAAGAGGTAGGAGG - Intergenic
1112188152 13:97147905-97147927 GAGTAGTGGGAAGAGGAAGGCGG + Intergenic
1112418386 13:99225300-99225322 GTACAGTGGGCGGAGGAAGGGGG - Intronic
1114179168 14:20350791-20350813 TTCCAGTGGGAACTCTAAGGAGG - Intronic
1114243712 14:20893105-20893127 GTCACGTGGGAAGGAGAAGGGGG + Intergenic
1114635398 14:24184237-24184259 GTCCAGTGGGAAGACAGGAGGGG + Intronic
1119781098 14:77277397-77277419 GTCCAATGGCAGGACTAAGGTGG - Exonic
1122905907 14:104801418-104801440 GTCCAGTAGGCGGCCGAAGGCGG - Exonic
1123868851 15:24551343-24551365 GTACAGTGGGAAACCGAAGGGGG + Intergenic
1124640891 15:31395921-31395943 GTCCAGTAGGCAGAGGATGGAGG - Intronic
1124889203 15:33716383-33716405 GTCCAGTGGGAGAACGAAGAAGG - Intronic
1125434255 15:39628386-39628408 GTCCACTGCGAAGACGTAGGAGG + Intronic
1129265173 15:74389479-74389501 GTCCAGGAGGGAGACGAAGCTGG + Intergenic
1129609293 15:77040044-77040066 GGCCAGTGGGAGGAGAAAGGGGG + Intergenic
1130224124 15:82045113-82045135 GTCCTTTGGGAGGAGGAAGGAGG - Intronic
1131428696 15:92368672-92368694 GTGCAGGGAGATGACGAAGGTGG - Intergenic
1132837184 16:1959919-1959941 GTGCAGTGGGAGGCCAAAGGAGG - Intronic
1132846367 16:2002776-2002798 GGCCTGTGGGAAGAGGCAGGAGG - Intronic
1133781439 16:8942107-8942129 GGGCAGTGGGAAGGGGAAGGTGG + Intronic
1134041512 16:11072363-11072385 GTACATTGGGAAGCCGAAGCAGG - Intronic
1136936773 16:34475642-34475664 GACCACTGGTAAGACCAAGGGGG - Intergenic
1136963046 16:34872928-34872950 GACCACTGGTAAGACCAAGGGGG + Intergenic
1138207372 16:55134772-55134794 GGCCTGTGTGAAGAGGAAGGGGG - Intergenic
1138243129 16:55445263-55445285 GTCCAGTTGTGAGAGGAAGGAGG - Intronic
1138454727 16:57114687-57114709 GTGCAGTGGGCAGACACAGGTGG + Intronic
1139546185 16:67650781-67650803 GTCTAGAGGCAGGACGAAGGAGG - Intronic
1142115775 16:88355430-88355452 GTCCAGCGGGAAGATGAACATGG - Intergenic
1143504579 17:7356579-7356601 GACCTGAGGGAAGACGAGGGTGG - Exonic
1143634480 17:8156489-8156511 GACCAATGAGAAGACGATGGCGG - Intronic
1144245237 17:13356309-13356331 GTACACTGAGAAGACGAAGGAGG - Intergenic
1144468538 17:15516507-15516529 GGACCGTGTGAAGACGAAGGGGG - Intronic
1146509908 17:33437868-33437890 GGCCAGAGGGAACAGGAAGGTGG - Intronic
1146925437 17:36741232-36741254 GTTCAGTGGGAGGAAGGAGGAGG - Intergenic
1150061887 17:62075641-62075663 CTCCACTAGGAAGAAGAAGGGGG + Intergenic
1151472866 17:74328605-74328627 GTTCAGTGAGTAGAGGAAGGAGG - Intronic
1152614087 17:81329959-81329981 GTCCACTGGGCAGAGGAGGGTGG - Intronic
1153381201 18:4441364-4441386 GACAAGTGGGAAGAGAAAGGTGG + Intronic
1155076682 18:22363441-22363463 GTCCAGAGGAAAGATGATGGAGG - Intergenic
1160804585 19:986573-986595 GTCCAGCGGTAAGAAAAAGGAGG - Intronic
1162692105 19:12441333-12441355 GTCCAGGAGGAAGAAGCAGGAGG - Intronic
1162810747 19:13163207-13163229 GCCCAGCGGGAAGGCGGAGGCGG + Intergenic
1163283300 19:16330539-16330561 GTGAAGTGGGAGGAGGAAGGGGG + Intergenic
1163377759 19:16944187-16944209 CTCCGGTGGGAAGAGGTAGGAGG + Intronic
1165315969 19:35055659-35055681 GTCCAGAGGGGAGGGGAAGGGGG - Intronic
1165843267 19:38802192-38802214 GTCCAGTGGGAAGAGGCCAGTGG + Intronic
1167261618 19:48462131-48462153 CTCCAGCGCGAAGAGGAAGGCGG - Exonic
926795174 2:16613020-16613042 GTCAAGGAGGAAGACGAATGAGG - Intronic
927212731 2:20648616-20648638 GTACAGTGAGAGGAAGAAGGAGG - Intronic
930121976 2:47768003-47768025 GGACAGTGGGAAGATGAAAGAGG + Intronic
931286105 2:60833235-60833257 ATTCAGTGGGAAGTCTAAGGGGG - Intergenic
934655570 2:96115375-96115397 GTCCACTGGGGAGAAGGAGGAGG - Exonic
936043375 2:109167039-109167061 GTCCCGTGGGAATACCATGGAGG + Intronic
940780093 2:157924239-157924261 GACCAGTGGGAATGTGAAGGTGG + Intronic
941333731 2:164212954-164212976 GTCCAGATGGAAGATGAAGGAGG + Intergenic
942894863 2:181040259-181040281 GTCCCGTGGAAGGACGAAGAAGG - Intronic
943726809 2:191260013-191260035 GTAGAGTGAGAAGAGGAAGGCGG + Intronic
944529532 2:200653585-200653607 GCCCTGTGGGACGATGAAGGCGG - Intronic
946368722 2:219267072-219267094 GATCAGTGGGGAGAAGAAGGAGG + Intronic
946417702 2:219548855-219548877 GTCCAGTGGAAAGATGATGATGG + Intronic
947063460 2:226192989-226193011 GTCTGGTGGGAAGAGGAATGGGG + Intergenic
948129765 2:235591907-235591929 ATCATGTGGGAAGACGAAGGGGG - Intronic
1169158139 20:3351730-3351752 TTCTTGTGGGAAGAGGAAGGAGG + Intronic
1169331532 20:4720370-4720392 GTCTAGTGGGAACAGGCAGGGGG + Intergenic
1170792177 20:19517363-19517385 GTCCAGAGGGGAGATGGAGGTGG - Intronic
1170836939 20:19892675-19892697 GTCTAGAAGGAAGAGGAAGGAGG - Intronic
1172518945 20:35554965-35554987 GTCCAGGGGGAGGAAGGAGGAGG + Intronic
1173226055 20:41163030-41163052 GCCCAGTGGAGAGATGAAGGGGG - Intronic
1173548014 20:43914440-43914462 GTGCGGGGGGAAGAGGAAGGTGG - Intergenic
1174181909 20:48680278-48680300 GTCCAGGTGGGAGGCGAAGGTGG - Intronic
1175222719 20:57426615-57426637 GTGCTGTGGGAGGACTAAGGAGG - Intergenic
1175268120 20:57714829-57714851 GTCCAGTGGGACGGCCAGGGAGG - Intergenic
1175578683 20:60081878-60081900 GCCCACTGGAAAGACGATGGAGG + Intergenic
1176052874 20:63129852-63129874 GTGCACCTGGAAGACGAAGGAGG - Intergenic
1178603478 21:34015109-34015131 GTCATGGGGGAAGATGAAGGGGG + Intergenic
1178761013 21:35402998-35403020 GTGCCATGAGAAGACGAAGGTGG - Intronic
1181875342 22:25936071-25936093 GTCCAGTGGGGAGACAGACGTGG + Intronic
1182005175 22:26953658-26953680 GTCCAGAGAGAGGACGATGGGGG + Intergenic
1182416235 22:30223160-30223182 GTCCAGTGGGAAGACGGACATGG - Intergenic
1182800925 22:33031470-33031492 GTCCAGTGGGGAGATGTCGGTGG - Intronic
1184164073 22:42717158-42717180 GTCCAGAGGGAAGACAAAGGTGG + Intronic
950625673 3:14244852-14244874 ATCAAGAGGGAAGAGGAAGGAGG - Intergenic
950800073 3:15543556-15543578 GTCCAGTAGAAATATGAAGGTGG + Intergenic
951580696 3:24159782-24159804 GTCCAGTGGGAAGAGGGACCAGG + Intronic
955057430 3:55469059-55469081 GCTCAGTGTGAAGAGGAAGGTGG + Exonic
955956291 3:64293322-64293344 GACCAGACGAAAGACGAAGGCGG - Intronic
956399484 3:68861835-68861857 GCACACTGAGAAGACGAAGGTGG + Intronic
956808041 3:72836517-72836539 GGCCAGGGGGAAGAGGAAAGAGG - Intronic
958726460 3:97911168-97911190 GGCCTTTGGGAAGACGAGGGAGG + Intronic
959115518 3:102173412-102173434 GGCCAGTGAGATGACTAAGGTGG + Intronic
960742792 3:120853304-120853326 GTAAAGTGGGAAGACCAGGGAGG + Intergenic
961453061 3:127011215-127011237 GTCCACTGGGGAGAGGCAGGTGG - Intronic
962407089 3:135109727-135109749 GTGCAGTGGGAGAAGGAAGGAGG + Intronic
962724818 3:138213911-138213933 GTACAGTGGAGAGACCAAGGCGG + Intronic
965771407 3:172185301-172185323 GTACAGTGGGAAGAAGATGAGGG - Intronic
967216789 3:187218054-187218076 GTCCACAGGTAAGACGGAGGAGG - Intronic
967955233 3:194872626-194872648 GTCCTGTGGGAAGAGGGAAGGGG + Intergenic
968441335 4:626009-626031 GTCCAGTGGGAAGACGATCTCGG - Exonic
969621796 4:8282348-8282370 GCCCAGTGGGCAGAAGGAGGAGG - Intronic
970518311 4:16857488-16857510 GTCCAGTGGGAAGCCACAGGAGG - Intronic
980509275 4:133763469-133763491 GACCATTTGGAAGACCAAGGCGG + Intergenic
981945701 4:150341079-150341101 GTCCAGTGGGGAGAGTATGGTGG + Intronic
983644639 4:169977393-169977415 GAAGAGAGGGAAGACGAAGGAGG + Intergenic
984015526 4:174421472-174421494 GTACAGTGGGAACACAAAAGTGG - Intergenic
986142918 5:5048688-5048710 GTCCATTGGGAATAGGAAGAAGG - Intergenic
988083350 5:26441305-26441327 GTCTAGTGGGAAGACAAACATGG + Intergenic
989237776 5:39169541-39169563 CTCCAGTTGAAAGACCAAGGAGG + Intronic
989466499 5:41762137-41762159 GTCCAGTGCGAAAACCAAAGTGG - Exonic
989503022 5:42191380-42191402 GTTCCGTGGGAACACAAAGGAGG + Intergenic
990615879 5:57507866-57507888 TTCCAGTGGGCAGAGAAAGGAGG - Intergenic
991001409 5:61787298-61787320 GTACAGTGGGAAGAATATGGAGG + Intergenic
991118338 5:62980763-62980785 GTCTAGTGGGGAGGCTAAGGAGG - Intergenic
991578647 5:68131271-68131293 GTCCAGTGGGAATATGAAGCAGG - Intergenic
992423184 5:76627177-76627199 GTCCAGTTGGGAGATGATGGGGG + Intronic
992894715 5:81236003-81236025 TGCCAGTGTGAAGAGGAAGGTGG - Intronic
996212290 5:120826276-120826298 GTAAAGTGAGAAGATGAAGGAGG + Intergenic
1002209137 5:177585611-177585633 GCCCAGTGGGAAGGCGAGGCAGG - Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1004046080 6:12024924-12024946 GCCCAGTGGCAAGAGGGAGGTGG + Intronic
1005280844 6:24271682-24271704 TTCCAGTGGGAAAACAAATGAGG - Intronic
1005386846 6:25293726-25293748 GTCAAAAGGGAAGAGGAAGGGGG - Intronic
1005495400 6:26383561-26383583 GAGAAGTGGGAAGAGGAAGGAGG + Intronic
1005906333 6:30264090-30264112 TTCCAGTGGGAAGAGGCAGACGG + Intergenic
1007766936 6:44166160-44166182 GGGCAGTGGCAAGAGGAAGGGGG + Intronic
1008523072 6:52381040-52381062 GTTCAGTGGGAGGAGGAGGGTGG - Intronic
1009306119 6:62091154-62091176 GTCCAGTGGGATCAAGAACGTGG - Intronic
1011745749 6:90406421-90406443 GATCAGTGGAAAGAGGAAGGTGG + Intergenic
1013365420 6:109433995-109434017 GTCCAGTGGGAATTCAAAAGAGG + Intronic
1016656682 6:146526222-146526244 GGTCAGTGGGAAGATCAAGGGGG - Intergenic
1018036956 6:159889819-159889841 TCCCAGTGGGAAGAAGAAAGGGG - Intergenic
1019572679 7:1720260-1720282 CTCCAGTGGGAAGACGAAGATGG + Intronic
1019625499 7:2013847-2013869 GTGCAGTGGGAAGAAGGAGCTGG - Intronic
1021938068 7:25651307-25651329 GCCCAGGGGGAAGAGGAAGCAGG + Intergenic
1022004880 7:26258257-26258279 GTCCAGTGGGATGCCAAATGGGG + Intergenic
1025977353 7:66379352-66379374 GGCCAGTGGGAGGCAGAAGGTGG + Intronic
1026470745 7:70693001-70693023 GTACAGTGGGCACACCAAGGTGG - Intronic
1029005136 7:97201412-97201434 GGCCAATGGGAAGAAGCAGGTGG - Intergenic
1029544483 7:101203013-101203035 GTCCCCTGGGAAGAGGATGGTGG + Intergenic
1033651884 7:143350203-143350225 GTCCCCTGGGAAGAAGGAGGAGG + Intronic
1034385837 7:150740350-150740372 GTCCAGTGGGAGGATGGAAGTGG - Intronic
1034787976 7:153942697-153942719 GTGCAGTGGGCACAGGAAGGTGG + Intronic
1035286075 7:157808080-157808102 GTCCAGTGGGAAGACATGGGTGG - Intronic
1037763341 8:21756628-21756650 TCCCACTGGGAAGAAGAAGGTGG + Intronic
1038605088 8:28993555-28993577 CTCCAGTGGAATGAAGAAGGGGG + Intronic
1038995385 8:32917192-32917214 ATCCAGAGGGAAGGAGAAGGTGG - Intergenic
1039563458 8:38531511-38531533 GGCCCTTGGGAAGAGGAAGGAGG + Intergenic
1039777254 8:40749248-40749270 GTCCACTGGAAAGGAGAAGGAGG + Intronic
1042054842 8:64753855-64753877 CTCCAGTCAGAAGAGGAAGGGGG + Intronic
1042852749 8:73233111-73233133 GGGGAGTGGGAAGAAGAAGGAGG - Intergenic
1045663056 8:104457994-104458016 GTCCAGTGGGAAGACGAAGGTGG - Intronic
1046803543 8:118455093-118455115 GTCCAGTGGGAGGATGAGGAAGG - Intronic
1046955039 8:120054032-120054054 GTCCAGTGAAAAGACGAAGCGGG - Intergenic
1047388376 8:124430428-124430450 GTACAGTGGGAAGACAGTGGAGG + Intergenic
1047403211 8:124563044-124563066 GAGCAGTGGTAAGAGGAAGGAGG + Intronic
1047958878 8:129996466-129996488 TGCCAGTGGGAAGACCCAGGAGG + Intronic
1049420618 8:142514940-142514962 GGGCAGTGGCAGGACGAAGGTGG + Intronic
1051142520 9:13993134-13993156 CTACAGTGGGAAGACAAAAGGGG - Intergenic
1052820170 9:33132216-33132238 GTGAAGTGGGAAGAGGAGGGAGG + Intronic
1056006254 9:82274648-82274670 GTGCAATGGGAACACAAAGGAGG - Intergenic
1056200881 9:84275351-84275373 TACCAGTGGGAAGACACAGGCGG + Intergenic
1057795105 9:98150248-98150270 GTCCAGTGGGAAGCCACTGGAGG - Intronic
1059430067 9:114244658-114244680 GTCCAGGGAGGAGCCGAAGGGGG + Intronic
1060313770 9:122489157-122489179 GTGCTGTGGGAACACAAAGGGGG + Intergenic
1061238832 9:129357671-129357693 TGCCAGTGGGGAGACGGAGGGGG - Intergenic
1062624011 9:137434897-137434919 GACTAGTGGGAAGGCGGAGGTGG - Exonic
1185927249 X:4161230-4161252 ATCCAGTGTGAAGAGAAAGGGGG + Intergenic
1188391083 X:29620506-29620528 GTCAAGTGGGAAGAGGAAATGGG - Intronic
1190092373 X:47450764-47450786 GTCCAGTGGGAAGAGGGAAGAGG - Intronic
1190630273 X:52379333-52379355 GTACAGAGGGAGGACTAAGGCGG + Intergenic
1190712286 X:53079433-53079455 GTGGGGTGGGAAGACCAAGGGGG + Exonic
1194256504 X:91642221-91642243 GTCCAGTGGGATGGCAAATGAGG - Intergenic
1198112682 X:133515434-133515456 GCGCAGTGGGAATACGTAGGGGG - Intergenic
1198438843 X:136641948-136641970 GTGCTGTGGGAACAAGAAGGAGG - Intergenic
1198766741 X:140087977-140087999 GCCCTGTGGGAAGACAGAGGTGG - Intergenic
1199500652 X:148501849-148501871 TCCCAGTGGGAGGCCGAAGGGGG - Intronic
1200273615 X:154711627-154711649 GTCTAGTGGGATGATGAATGAGG + Intronic
1200575227 Y:4881498-4881520 GTCCAGTGGGATGGCAAATGAGG - Intergenic