ID: 1045663662

View in Genome Browser
Species Human (GRCh38)
Location 8:104464417-104464439
Sequence TGCTTCATCTGGAACCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045663659_1045663662 -5 Left 1045663659 8:104464399-104464421 CCACTTCCTCTTCTTTGCTGCTT 0: 1
1: 0
2: 10
3: 140
4: 1143
Right 1045663662 8:104464417-104464439 TGCTTCATCTGGAACCCTGATGG No data
1045663654_1045663662 11 Left 1045663654 8:104464383-104464405 CCTCCCCCACAGCATTCCACTTC 0: 1
1: 0
2: 4
3: 36
4: 327
Right 1045663662 8:104464417-104464439 TGCTTCATCTGGAACCCTGATGG No data
1045663653_1045663662 12 Left 1045663653 8:104464382-104464404 CCCTCCCCCACAGCATTCCACTT 0: 1
1: 1
2: 2
3: 31
4: 349
Right 1045663662 8:104464417-104464439 TGCTTCATCTGGAACCCTGATGG No data
1045663656_1045663662 7 Left 1045663656 8:104464387-104464409 CCCCACAGCATTCCACTTCCTCT 0: 1
1: 1
2: 4
3: 33
4: 322
Right 1045663662 8:104464417-104464439 TGCTTCATCTGGAACCCTGATGG No data
1045663652_1045663662 13 Left 1045663652 8:104464381-104464403 CCCCTCCCCCACAGCATTCCACT 0: 1
1: 0
2: 3
3: 63
4: 517
Right 1045663662 8:104464417-104464439 TGCTTCATCTGGAACCCTGATGG No data
1045663658_1045663662 5 Left 1045663658 8:104464389-104464411 CCACAGCATTCCACTTCCTCTTC 0: 1
1: 0
2: 1
3: 52
4: 486
Right 1045663662 8:104464417-104464439 TGCTTCATCTGGAACCCTGATGG No data
1045663655_1045663662 8 Left 1045663655 8:104464386-104464408 CCCCCACAGCATTCCACTTCCTC 0: 1
1: 0
2: 4
3: 29
4: 382
Right 1045663662 8:104464417-104464439 TGCTTCATCTGGAACCCTGATGG No data
1045663657_1045663662 6 Left 1045663657 8:104464388-104464410 CCCACAGCATTCCACTTCCTCTT 0: 1
1: 0
2: 5
3: 34
4: 304
Right 1045663662 8:104464417-104464439 TGCTTCATCTGGAACCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045663662 Original CRISPR TGCTTCATCTGGAACCCTGA TGG Intronic
No off target data available for this crispr