ID: 1045674090

View in Genome Browser
Species Human (GRCh38)
Location 8:104589057-104589079
Sequence GAGGGAGCGCGCGCGGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 810
Summary {0: 1, 1: 2, 2: 14, 3: 99, 4: 694}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045674090_1045674106 18 Left 1045674090 8:104589057-104589079 CCGCCGCCCGCGCGCGCTCCCTC 0: 1
1: 2
2: 14
3: 99
4: 694
Right 1045674106 8:104589098-104589120 TCGCCTGCTCCCACCCCGGGCGG 0: 1
1: 0
2: 1
3: 13
4: 143
1045674090_1045674094 -6 Left 1045674090 8:104589057-104589079 CCGCCGCCCGCGCGCGCTCCCTC 0: 1
1: 2
2: 14
3: 99
4: 694
Right 1045674094 8:104589074-104589096 TCCCTCCTCCCTCCTCCCTCCGG 0: 1
1: 5
2: 22
3: 215
4: 1330
1045674090_1045674104 14 Left 1045674090 8:104589057-104589079 CCGCCGCCCGCGCGCGCTCCCTC 0: 1
1: 2
2: 14
3: 99
4: 694
Right 1045674104 8:104589094-104589116 CGGCTCGCCTGCTCCCACCCCGG 0: 1
1: 0
2: 1
3: 21
4: 247
1045674090_1045674105 15 Left 1045674090 8:104589057-104589079 CCGCCGCCCGCGCGCGCTCCCTC 0: 1
1: 2
2: 14
3: 99
4: 694
Right 1045674105 8:104589095-104589117 GGCTCGCCTGCTCCCACCCCGGG 0: 1
1: 0
2: 2
3: 37
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045674090 Original CRISPR GAGGGAGCGCGCGCGGGCGG CGG (reversed) Intergenic