ID: 1045675506

View in Genome Browser
Species Human (GRCh38)
Location 8:104603399-104603421
Sequence GAGTCTCCAGCCTGCCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045675506_1045675510 23 Left 1045675506 8:104603399-104603421 CCAAGCTGGCAGGCTGGAGACTC 0: 1
1: 0
2: 4
3: 35
4: 229
Right 1045675510 8:104603445-104603467 CAAATTCAAAGATAGTCTGGAGG No data
1045675506_1045675509 20 Left 1045675506 8:104603399-104603421 CCAAGCTGGCAGGCTGGAGACTC 0: 1
1: 0
2: 4
3: 35
4: 229
Right 1045675509 8:104603442-104603464 GCTCAAATTCAAAGATAGTCTGG No data
1045675506_1045675508 -10 Left 1045675506 8:104603399-104603421 CCAAGCTGGCAGGCTGGAGACTC 0: 1
1: 0
2: 4
3: 35
4: 229
Right 1045675508 8:104603412-104603434 CTGGAGACTCAGGAAATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045675506 Original CRISPR GAGTCTCCAGCCTGCCAGCT TGG (reversed) Intronic
900484958 1:2918178-2918200 CACTCTCCTGCCTGCCGGCTCGG - Intergenic
901531204 1:9853609-9853631 CTGCCTCCAGGCTGCCAGCTGGG + Intronic
901686894 1:10948146-10948168 GACTCTCCATCCTGCCAGCGAGG - Exonic
901798447 1:11693525-11693547 GAGCCTGGAACCTGCCAGCTGGG - Intronic
902992215 1:20196288-20196310 GGGTGCCCACCCTGCCAGCTGGG + Intergenic
903046926 1:20571502-20571524 GTGTCTCCAGCAGGCCAGCCTGG - Intergenic
903285647 1:22275185-22275207 GAGACTCCAGCCTAGGAGCTGGG + Intergenic
903976498 1:27153843-27153865 CAGTCTCCATCCTGCCACCTTGG - Intronic
905310038 1:37042792-37042814 CAGGCTCCAGCCTTCCACCTGGG + Intergenic
905970954 1:42142064-42142086 GACTCTGCAGCCTGCCTGCCTGG - Intergenic
906055741 1:42915449-42915471 CAGTCTGCAGCCTCCCACCTGGG + Intergenic
906325299 1:44842015-44842037 GAGCCTTCAGGCTCCCAGCTAGG + Exonic
906608295 1:47185911-47185933 GAGTCTCCAGTCTGCAGGCCTGG - Intronic
906639620 1:47433838-47433860 GAGTCTCCCGCCTCCCACCTGGG + Intergenic
907365624 1:53957051-53957073 TAATCACCAGCCTGACAGCTAGG - Intronic
907710442 1:56875880-56875902 CTGTCTGCAGCCTCCCAGCTTGG - Intronic
908272721 1:62436744-62436766 GAGGCTCGAGCCCGCCAGCCAGG + Exonic
908443936 1:64183562-64183584 GTGTCTGCATCCAGCCAGCTGGG - Intergenic
912497715 1:110102146-110102168 CCGTCTCCAGCCTGCCGGCCAGG + Intergenic
912723991 1:112042966-112042988 TAGCCTCCAACTTGCCAGCTTGG + Intergenic
915062992 1:153202144-153202166 CAGACTCCAGTCTGCCAGATTGG - Intergenic
916239667 1:162626283-162626305 GAGACTCCAGCCTGGAAGCAAGG + Intergenic
916607937 1:166361405-166361427 AAGTCTCCAGGATGCCAGCATGG + Intergenic
916660776 1:166920940-166920962 GCGTCTCCAGGCTGCCACCGCGG + Exonic
922663420 1:227449262-227449284 GAGTCTCCAGGGTGCCCTCTGGG - Intergenic
923032832 1:230263479-230263501 GAGGCTCCCTCCTCCCAGCTAGG + Intronic
923499549 1:234553418-234553440 GGGTCTGCAGCCTGCCACGTGGG - Intergenic
924946889 1:248852510-248852532 GAGCCCACAGCCTTCCAGCTGGG + Intronic
1063168614 10:3486171-3486193 GAGGCTCCAGCCCGCCAGGAGGG + Intergenic
1069257497 10:66352204-66352226 GAGTCTTCAGTCTGACTGCTGGG - Intronic
1069899851 10:71701139-71701161 GAGCCTCCAGGCTGGGAGCTGGG + Intronic
1073452563 10:103618407-103618429 GACTCTTTAGCCAGCCAGCTAGG - Intronic
1075464059 10:122638237-122638259 GAGTCTCCAGGCTGCTCACTTGG - Intronic
1075532779 10:123244065-123244087 GAGTCTCCTGCCTGACAGACTGG + Intergenic
1075540195 10:123306489-123306511 GAGTCCCTAGACTGCCAGTTTGG + Intergenic
1076259773 10:129056023-129056045 GAGGCTGCAGCCTGCCTGTTTGG + Intergenic
1076356550 10:129857700-129857722 CAGTCTCCATCCTGGCAGCCCGG - Intronic
1076630520 10:131849416-131849438 GTGTCTCCTGGCTGCCAACTAGG - Intergenic
1077010053 11:375680-375702 CAGTCTCCAGCCAGCCACGTGGG + Exonic
1077328364 11:1973304-1973326 TAGTCTCCCGCCTGCCAGCCCGG - Intronic
1077556732 11:3229676-3229698 CAGTCCCCAGCCCTCCAGCTTGG + Intronic
1077598825 11:3558151-3558173 GAGTCTGCAGCCAGCAAGCTGGG + Intergenic
1077601727 11:3579489-3579511 GAGTCTGGAGCCAGGCAGCTGGG - Intergenic
1079160791 11:17991973-17991995 TAGTCTCCAGTCTACCAGCAGGG + Intronic
1079705210 11:23607313-23607335 GAGCCTCCACCCTGCCAGTTAGG + Intergenic
1079845880 11:25466927-25466949 GAGTCTCCAGCCTGCACTCCAGG - Intergenic
1080394238 11:31875170-31875192 AAATCTCCAGGCAGCCAGCTGGG - Intronic
1081520004 11:43872470-43872492 CACACTCCAGCCTGCCAGCCTGG + Intergenic
1081876981 11:46415078-46415100 CAGGATCCAGCCAGCCAGCTGGG - Intronic
1082997291 11:59264144-59264166 GAGTCTACTGCCTGCCAGGCAGG - Intergenic
1083299086 11:61730892-61730914 GAGGCCCCAGCCCTCCAGCTGGG - Intronic
1083479170 11:62932881-62932903 GAGTCACTGGCCTGCCATCTAGG - Intergenic
1083587254 11:63869324-63869346 GAGTCTGCAGGCTTCCAGGTGGG - Intronic
1083756006 11:64792041-64792063 GCGGCTCCAGCATCCCAGCTGGG + Exonic
1083887384 11:65579439-65579461 GAGTCTCTAGCCCTCCAGCATGG + Intronic
1084254901 11:67934047-67934069 GAGTCTGCAGCCAGCAAGCTGGG + Intergenic
1084880972 11:72171671-72171693 GAGACTCCACCCTCCCAGGTGGG + Intergenic
1084959806 11:72710453-72710475 GAAGCTCCAGGCTGCCAGCGCGG + Exonic
1088804586 11:113340607-113340629 GAGACACCAGCCAGCCAGTTTGG + Intronic
1089501037 11:118931238-118931260 GATCCTCCTGCCTGCTAGCTGGG - Intronic
1090137116 11:124210052-124210074 GAGTTCCCACCCTGCCAGCTTGG + Intergenic
1090747488 11:129718787-129718809 GAGTCACCATCCTGACAGCATGG + Intergenic
1091308173 11:134554163-134554185 GAGTCTGCACCCTGGCAGCAGGG - Intergenic
1202811342 11_KI270721v1_random:28483-28505 TAGTCTCCCGCCTGCCAGCCCGG - Intergenic
1091692235 12:2605191-2605213 GAGTCTCCAGCCAGCCCATTGGG + Intronic
1091932781 12:4410126-4410148 GAGTCACCAGCTTCCCAGCCTGG - Intergenic
1092283596 12:7115599-7115621 CAGTCCCCAGCCTGCCACCTAGG - Intergenic
1095206283 12:39443339-39443361 GAGTCCCCAGCCTGGCCGCTGGG - Intronic
1097044705 12:56178862-56178884 GAGGCTCCAGCCTTACATCTTGG - Intronic
1097674432 12:62583304-62583326 GAGTCTCTAGTCTGTCACCTAGG - Intronic
1101436523 12:104669141-104669163 GTGTCTCCTGCCAGCCAGCTGGG + Intronic
1102026317 12:109715820-109715842 GGAACTTCAGCCTGCCAGCTGGG - Intronic
1102598251 12:114009392-114009414 GCCTCTCCATCCTGCCATCTGGG - Intergenic
1103885222 12:124195368-124195390 GAGGCTCTAGCCAGCCAGCACGG - Intronic
1104562101 12:129854829-129854851 GAGTCTCCAGCCAGATGGCTCGG - Intronic
1105788242 13:23770583-23770605 AACTCCCCTGCCTGCCAGCTTGG + Intronic
1113528773 13:111004493-111004515 GGGTCTGAAGCCTGACAGCTTGG - Intergenic
1113746590 13:112749659-112749681 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746627 13:112749845-112749867 GAGTCTCCATCCTCCCATGTGGG + Intronic
1113746647 13:112749939-112749961 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746667 13:112750033-112750055 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746686 13:112750126-112750148 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746705 13:112750219-112750241 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746724 13:112750312-112750334 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746742 13:112750405-112750427 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746760 13:112750499-112750521 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746778 13:112750592-112750614 GAGTCTCCATCCTCCCACGTGGG + Intronic
1114482248 14:23043091-23043113 GAGACTCCAGGATGCCAGCAGGG + Exonic
1115046486 14:29001058-29001080 GAGGCTATAGCCAGCCAGCTGGG + Intergenic
1118823624 14:69361397-69361419 GGCCCTCCATCCTGCCAGCTGGG - Intergenic
1121469313 14:94139612-94139634 GGGCCTCCGGCCTGCCAGCATGG + Intergenic
1122878435 14:104679324-104679346 GATTCCCCAGCCGGCCCGCTGGG + Intergenic
1124603363 15:31152287-31152309 GATTCACCAGCCTCCAAGCTGGG - Intronic
1125966041 15:43876351-43876373 GAGTCTCAAGTCTGCCTGTTGGG + Intronic
1128072577 15:64806962-64806984 AAATCTGGAGCCTGCCAGCTTGG + Intergenic
1129716110 15:77852064-77852086 GAGTCACCAGCCCACCAGCCTGG + Intergenic
1129737866 15:77975904-77975926 GAAACTCCAGCCTCCCTGCTCGG - Intergenic
1129848215 15:78777706-78777728 GAAACTCCAGCCTCCCCGCTCGG + Intronic
1130253710 15:82316230-82316252 GAAACTCCAGCCTCCCCGCTCGG - Intergenic
1131291462 15:91110603-91110625 GAGCCTCCCACGTGCCAGCTGGG - Intronic
1132889108 16:2195655-2195677 GGGTCTCCAGCTTCCCTGCTGGG - Intronic
1132977880 16:2719637-2719659 GAGCCTGCAGCCAGCCTGCTGGG + Intronic
1133047832 16:3099022-3099044 GAGCCTCGTGCCAGCCAGCTTGG - Intronic
1133738201 16:8631602-8631624 CAGTCTCCCTCCTCCCAGCTTGG - Intronic
1135876322 16:26203740-26203762 GGGTCTCCAGCCTGCTTGGTGGG + Intergenic
1136413283 16:30089342-30089364 CAGCCTCCAGCCTGCCCTCTGGG - Intronic
1137557843 16:49483952-49483974 CATCCTCCAGCCTGCCGGCTGGG - Intergenic
1139591125 16:67933835-67933857 GAGTCTCAGGCCTGGCTGCTGGG - Intronic
1140216171 16:73010647-73010669 GAGACTTCTGGCTGCCAGCTCGG - Intronic
1140257814 16:73351768-73351790 GGGTCTCCAGCCTTCCAGGGGGG + Intergenic
1140376610 16:74450008-74450030 GAGCCTCCAGCCTGGCAGTCCGG + Intergenic
1143376780 17:6471780-6471802 GGGACTCCAGCCTGAGAGCTAGG + Intronic
1144438197 17:15259910-15259932 GAGTCTCCAGCCTGTCACCCGGG - Intronic
1146842572 17:36166152-36166174 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146854884 17:36254111-36254133 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146865736 17:36334265-36334287 GGGTGTTCAGCCTGCCAGCAGGG - Exonic
1146870784 17:36378003-36378025 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146882092 17:36450231-36450253 GGGTGTTCAGCCTGCCAGCAGGG + Intergenic
1147068606 17:37934877-37934899 GGGTGTTCAGCCTGCCAGCAGGG - Exonic
1147073668 17:37978627-37978649 GGGTGTTCAGCCTGCCAGCAGGG + Intronic
1147080128 17:38014414-38014436 GGGTGTTCAGCCTGCCAGCAGGG - Intronic
1147085189 17:38058165-38058187 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1147096077 17:38138374-38138396 GGGTGTTCAGCCTGCCAGCAGGG - Intergenic
1147101135 17:38182131-38182153 GGGTGTTCAGCCTGCCAGCAGGG + Intergenic
1147254331 17:39173231-39173253 AAGTCCACATCCTGCCAGCTGGG + Intergenic
1149314215 17:55423088-55423110 GAGTCTCTAGCCTGCAGGCTGGG - Intergenic
1152491774 17:80639720-80639742 GACTCTCCCACCTCCCAGCTGGG - Intronic
1152722635 17:81930334-81930356 CTGACTCCAGCTTGCCAGCTGGG - Intergenic
1152722704 17:81930734-81930756 GAGTCCCCAGCAGGCCAGGTGGG - Intergenic
1153068947 18:1082459-1082481 GAGTCACCTGCATGTCAGCTAGG + Intergenic
1153818227 18:8809494-8809516 GCTTCACCAGGCTGCCAGCTGGG + Intronic
1153823968 18:8857241-8857263 GACTCTCCAGACAGTCAGCTGGG + Intergenic
1157482976 18:48067634-48067656 GGGTCTCCAGTCTGCTAGCCTGG + Intronic
1157600648 18:48891090-48891112 GGGCCTCCTGACTGCCAGCTGGG - Intergenic
1158401066 18:57121968-57121990 GAGGATCCTGCCAGCCAGCTGGG + Intergenic
1158665400 18:59428199-59428221 CTGTCTCCAGCCTGCCAGCCTGG + Intergenic
1160507428 18:79434977-79434999 AAGTCTCCACCCTCCCAGGTGGG + Intronic
1161291262 19:3494540-3494562 GAGTCTCCAGCCGGCAGGCCCGG - Intronic
1161453507 19:4359365-4359387 GGGTCACCAGTCTGCCAGCTGGG - Intronic
1161567781 19:5013061-5013083 GAGCCTCCAGCCTCCCAGCTTGG + Intronic
1162142042 19:8590986-8591008 GACTTTTCAGCCTCCCAGCTGGG - Intronic
1162743523 19:12786561-12786583 GAGCGTCCAGACTGGCAGCTGGG - Intronic
1165069438 19:33247231-33247253 GAAACCCCAGCCTGCCAGCAGGG - Intergenic
1165092576 19:33394697-33394719 GTGTCTCCAGGCTGCCAGGGTGG - Intronic
1165792146 19:38499115-38499137 GAGGCCACAGCCTGCCAGGTAGG - Exonic
925671114 2:6310819-6310841 ATGTCTCCAGGCTGCTAGCTGGG - Intergenic
925931846 2:8714440-8714462 GCGTCTGCAGCCAGCAAGCTGGG + Intergenic
926146894 2:10401783-10401805 AAGCCTCCAGCTTCCCAGCTGGG - Intronic
926953815 2:18272097-18272119 GAGCTCCCACCCTGCCAGCTTGG + Intronic
928267187 2:29821791-29821813 CAATCTCCTGCCTGCCAGCCAGG + Intronic
932008354 2:67950153-67950175 GAAATTCCAGCCTGACAGCTCGG - Intergenic
935172417 2:100620739-100620761 GAGTCCCCAGCCTCTAAGCTAGG - Intergenic
936095355 2:109526924-109526946 GAGGCTCGAGCCTGCCTGCGTGG + Intergenic
938252833 2:129828855-129828877 GAGCCATCAGCCAGCCAGCTGGG + Intergenic
939401468 2:141700271-141700293 GAGTTTACAGTCTGCCAGCGGGG - Intronic
940932998 2:159458035-159458057 GAGTCTCCAGCCACCCAGGCTGG + Intronic
945373027 2:209044514-209044536 GTGCCTCCAGCCAGACAGCTGGG + Intergenic
946460396 2:219863575-219863597 GAATCCCCAGCCTCCCAGGTGGG - Intergenic
947746192 2:232508480-232508502 GACCCTCCAGCCTGGCAGGTGGG + Intergenic
1168851564 20:980552-980574 GAGTCTCCTGCCTCGCAGCTGGG + Intronic
1170399890 20:15970537-15970559 AACTCTCCAGGCAGCCAGCTGGG - Intronic
1170571788 20:17636808-17636830 TGCTCTCCAGCCTCCCAGCTCGG - Intronic
1172676617 20:36677138-36677160 GAGCTCCCAGCCCGCCAGCTGGG - Intronic
1172772734 20:37391119-37391141 GAGTCTCCAGCCACCCAGAGTGG - Intronic
1173201557 20:40958936-40958958 GAGTCTCCAAACTGGGAGCTGGG + Intergenic
1173957918 20:47048796-47048818 GAGTCTTGAGCCTCCCAGCCTGG - Intronic
1174178964 20:48662957-48662979 GAGCCTCCCGCCAGTCAGCTGGG - Intronic
1175074254 20:56359865-56359887 GAGGCTCCAGACTGCCAGGCCGG - Intronic
1175160469 20:57004229-57004251 TACACTCCAGCCTGGCAGCTGGG + Intergenic
1175706595 20:61183167-61183189 GGGTCCCCAGCCTGCCAGCAAGG + Intergenic
1175725848 20:61317813-61317835 GGGTGTCCAGCCAGCCAGCAAGG + Intronic
1178093378 21:29188168-29188190 CAGTCTTGAGCCTGCCAACTGGG - Intergenic
1178511962 21:33212847-33212869 GGGTCTCCAGCCTGCTGGCCTGG - Intergenic
1181169500 22:21000302-21000324 CAGGCTCCAGCCTCCCAGCTGGG + Exonic
1182008391 22:26980297-26980319 CTTTCTCCAACCTGCCAGCTGGG + Intergenic
1182239358 22:28902634-28902656 GAGTCTGGAGCCAGACAGCTTGG + Intronic
1182636010 22:31727628-31727650 GAGTCTCCAGCCTTCCTGTGAGG - Intronic
1182658611 22:31909167-31909189 GAGTCTCCACCTTCCTAGCTAGG + Intergenic
1183984481 22:41562005-41562027 GAGCCTGCAGGCTGGCAGCTTGG - Intronic
1185030399 22:48439954-48439976 GAGGCTCCATGCTCCCAGCTGGG + Intergenic
949900724 3:8812814-8812836 GAGTCTCCAGCAAGCCATCCAGG + Intronic
950152410 3:10697958-10697980 GACTCTCCTGCCTCCCATCTAGG - Intronic
950751635 3:15133702-15133724 AAGTCTGCAGCCAGCAAGCTGGG - Intergenic
950868470 3:16208717-16208739 GACTCTGCAGCCTGCCTGCCTGG + Intronic
952262626 3:31755170-31755192 GAGTTTCCAGCCTTCCAGGATGG + Intronic
952926915 3:38326874-38326896 GGCTCTCCAGCCTGGCACCTAGG - Intergenic
952926926 3:38326941-38326963 GGCTCTCCAGCCTGGCACCTAGG - Intergenic
952954403 3:38548340-38548362 CAGTCTCCTTCCGGCCAGCTGGG + Exonic
953341697 3:42139979-42140001 GAGTCTGCCTCCTGCCAGCCTGG - Intronic
953610906 3:44446401-44446423 GAGTCCCCAGCCTGCCTGCTAGG - Exonic
954446847 3:50551466-50551488 GGGCCTCCAGCCTGCTAGCAGGG + Intergenic
956248686 3:67212986-67213008 GAGTCTCTGGCCTGATAGCTAGG + Intergenic
959838049 3:110943798-110943820 AAGCCTCGAGCCTGCCAGCTTGG - Intergenic
962411748 3:135146889-135146911 AAGTCCCCAGCCTGGCAGGTGGG + Intronic
962422888 3:135243626-135243648 GAGGCTTCAGCCCGGCAGCTGGG - Intronic
962538152 3:136350112-136350134 GAGTCTCCAGACTGTCACCCAGG - Intronic
962951633 3:140225101-140225123 GGGTCAGCAGCCTCCCAGCTCGG + Intronic
965757232 3:172039689-172039711 GATCCTCCAGGCTGCCGGCTGGG + Intronic
967685521 3:192411273-192411295 GACCTTCCAGGCTGCCAGCTGGG + Intronic
968166335 3:196468301-196468323 GAGTCTCCAGTCTGTCACCCAGG + Intergenic
969303694 4:6312687-6312709 GAGTCCCCAGGGTGACAGCTGGG - Intergenic
969398948 4:6940804-6940826 CAGCCTCCTGGCTGCCAGCTCGG - Intronic
969524860 4:7699255-7699277 GAGCCTGCAGCCTGCCAGTGGGG + Intronic
969740541 4:9022659-9022681 GAGTCTGCAGCCAGCAAGCTGGG - Intergenic
969799885 4:9555488-9555510 GAGTCTGCAGCCAGCAAGCTGGG - Intergenic
970696609 4:18685555-18685577 GGGTCTCCAGACTCCCAGCCTGG - Intergenic
971251623 4:24977275-24977297 GGATCTCCAACCTGCCAGCTTGG - Intronic
971934838 4:33134342-33134364 GAATCTCCAGTCTGCCTGCTTGG + Intergenic
974065665 4:57074542-57074564 GAGTCTCCAGCCTGACTTCAGGG + Intronic
975106535 4:70573865-70573887 GGGTCTCAAGCCTGCTAGCTTGG + Intergenic
975170347 4:71225549-71225571 GAGCCTCATCCCTGCCAGCTGGG + Intronic
975501278 4:75087961-75087983 GAATTTCCATCCTGCCAGCCTGG + Intergenic
980481994 4:133399226-133399248 AAATCTCCAACCTGCCAGCTTGG + Intergenic
980964069 4:139503402-139503424 GAGTCTGAAGCCGGGCAGCTGGG - Intronic
982187502 4:152818082-152818104 ATGTCTCCAGTCTGCCATCTTGG - Intronic
983650427 4:170031460-170031482 GAGTTTGCAGCTTGCCAGCTTGG + Intronic
990762480 5:59145293-59145315 CATTTTCCAGCCTGCCAGCCTGG - Intronic
990935842 5:61148221-61148243 GTGTCTCCAGCCAGAAAGCTGGG + Intronic
996183761 5:120451614-120451636 GAGGCTCCATCCTGCCAGCTCGG + Intergenic
996619505 5:125482909-125482931 GAGTCTCCCGCCTGTCACCCAGG - Intergenic
998401840 5:141852487-141852509 GAGTCTCCAGCCTCCCAGCCTGG + Intergenic
999255082 5:150205572-150205594 CAGCCACCAGCATGCCAGCTGGG - Exonic
1001621313 5:173087664-173087686 GAGACTCCAGTCTGCCAGACTGG - Intronic
1001746496 5:174096593-174096615 GACTCTCCAACAAGCCAGCTTGG - Intronic
1005098759 6:22146788-22146810 GGGTCTCCTGCCTCGCAGCTGGG + Intergenic
1006316894 6:33296719-33296741 GGGCCTCCAGAGTGCCAGCTCGG + Exonic
1007098984 6:39231583-39231605 CATTCTCCAGCCCTCCAGCTGGG + Intergenic
1007633684 6:43285878-43285900 GAGGCTCCAGCCTCCCCGCGAGG + Exonic
1007724492 6:43906845-43906867 GAGCGGCCAGCCTGCCAGCCAGG + Intergenic
1011004087 6:82624435-82624457 GAGTATGCAGACTGCCACCTAGG + Intergenic
1014802226 6:125790544-125790566 GGGTGCCCAGCCTCCCAGCTCGG + Intronic
1015786801 6:136927061-136927083 GAGTCTCCCACCTGCCAGCATGG - Intergenic
1020204726 7:6105386-6105408 GAGCCTCCCGCCTGCCTGCCCGG - Intronic
1021597893 7:22336567-22336589 GGGTCTTCAGACAGCCAGCTGGG + Intronic
1022550572 7:31235441-31235463 GACGCTCCAGACTGGCAGCTTGG + Intergenic
1023789043 7:43737489-43737511 GAGTTCCCACCCTGCCATCTTGG - Intergenic
1024063643 7:45716223-45716245 GAATCTCCAGGCTGCCATCGAGG + Exonic
1030124591 7:106141775-106141797 GGGTCTCCAACCTGCCAGACTGG - Intergenic
1030397595 7:109006852-109006874 GAGTCTCAAGAATTCCAGCTTGG - Intergenic
1033392592 7:140941971-140941993 GAATGTCTAACCTGCCAGCTAGG + Intergenic
1034265200 7:149777373-149777395 CAGACTCCAGCCTGCCAGACAGG + Intergenic
1035303673 7:157916322-157916344 GAGGCTCCAGCCGCCCATCTGGG - Intronic
1035439804 7:158887209-158887231 GAGTCTCCAGTGTGCCTTCTGGG - Intronic
1036255047 8:7199245-7199267 GAGTCTGCAGCCAGCAAGCTGGG + Intergenic
1036362442 8:8088262-8088284 GAGTCTGCAGCCAGCAAGCTGGG - Intergenic
1036642193 8:10591611-10591633 CAGTCTCCAGCCTGGCCCCTGGG - Intergenic
1036761186 8:11509540-11509562 GTGTTTCCAGTCTCCCAGCTCGG + Intronic
1036896124 8:12636909-12636931 GAGTCTGCAGCCAGCAAGCTGGG + Intergenic
1036898943 8:12657686-12657708 GAGTCTGGAGCCAGGCAGCTGGG - Intergenic
1045675506 8:104603399-104603421 GAGTCTCCAGCCTGCCAGCTTGG - Intronic
1046012439 8:108565676-108565698 GAGTCTCAACCCTGCCACCAGGG - Intergenic
1049209505 8:141378966-141378988 GACTCTGCCCCCTGCCAGCTAGG - Intergenic
1049454214 8:142678769-142678791 GGCTCTCCTGCCAGCCAGCTGGG - Intronic
1049670813 8:143869108-143869130 GAGTCTGCAGGCTGCCGCCTGGG + Exonic
1051063516 9:13073727-13073749 GAGTCTCCAGGCTGCAAGGCAGG + Intergenic
1052555530 9:30010650-30010672 AAGTATACTGCCTGCCAGCTGGG - Intergenic
1055791138 9:79924489-79924511 GGGTCTCCAGCTTGCCAACTAGG - Intergenic
1055852256 9:80645672-80645694 GAGTTTCCAGCCTACCAGCCTGG + Intergenic
1058318205 9:103595251-103595273 GTGCCTCCAGCCTGCTGGCTCGG + Intergenic
1059608900 9:115870094-115870116 GAGTCTCCTGCCAGCCTGCAGGG + Intergenic
1060410306 9:123395661-123395683 AAGTCTCCAAGATGCCAGCTGGG - Intronic
1060985477 9:127816834-127816856 GAGACTCCATCCTCCCAGCAAGG + Intronic
1061853347 9:133428801-133428823 GAGCCTCCAGCCAGCCCGCTGGG + Intronic
1061853395 9:133428957-133428979 GAGCCTCCAGCCAGCCCGCTGGG + Intronic
1062374257 9:136254858-136254880 GAGTCTTCAGCTTCCAAGCTGGG + Intergenic
1186670256 X:11759419-11759441 GAGTCTCCAGCTAGCCATCCTGG + Intronic
1186854196 X:13610383-13610405 GAGCCCCCAGCCTGCAAGCCAGG - Intronic
1187572666 X:20520876-20520898 AAGTCTCCATCCTGATAGCTGGG + Intergenic
1191780401 X:64858101-64858123 GATTCTCCAGGCTGAAAGCTTGG + Intergenic