ID: 1045676676

View in Genome Browser
Species Human (GRCh38)
Location 8:104615044-104615066
Sequence TGGGACTCCTGGGCCAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045676671_1045676676 -2 Left 1045676671 8:104615023-104615045 CCAGCTGAATTTGGGACAAGGTG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1045676676 8:104615044-104615066 TGGGACTCCTGGGCCAGAACTGG No data
1045676665_1045676676 23 Left 1045676665 8:104614998-104615020 CCAGTGGTGGGGGTGGGTGAAGG 0: 1
1: 1
2: 17
3: 147
4: 1395
Right 1045676676 8:104615044-104615066 TGGGACTCCTGGGCCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045676676 Original CRISPR TGGGACTCCTGGGCCAGAAC TGG Intronic
No off target data available for this crispr