ID: 1045682204

View in Genome Browser
Species Human (GRCh38)
Location 8:104674376-104674398
Sequence GGAAGACACAAGTGCCAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045682204 Original CRISPR GGAAGACACAAGTGCCAGTA AGG (reversed) Intronic
901240221 1:7688579-7688601 AGAAGACACAAGTGCTGGTTGGG + Intronic
903288270 1:22290675-22290697 GGAAGACACCAGCGCCAGGTGGG - Intergenic
906387375 1:45382287-45382309 GGAATACAGTAGTGCAAGTATGG + Intronic
908717575 1:67086824-67086846 AGAAGACACTAGTGCCATGAAGG + Intergenic
909345231 1:74577348-74577370 GGTTGACACAAGTGGCAGTAAGG - Intronic
909811183 1:79933145-79933167 GGAATACACAAGATCCATTAGGG + Intergenic
912020348 1:105101389-105101411 GCAAGACAAAAGTAACAGTAGGG + Intergenic
916689139 1:167173851-167173873 GGAAGAGACAAGTTCCAGAGAGG + Intergenic
918133404 1:181648013-181648035 GGAAGACACCAGCACCAGCAAGG - Intronic
918362331 1:183771897-183771919 GGAAGACACAAGTGGCTGGACGG + Intronic
921092231 1:211855158-211855180 AGAAGACACAAGTGGCTGGATGG - Intergenic
922308991 1:224370171-224370193 GGAAGAGAGAAGTCCCAGTTGGG + Intronic
924920809 1:248627160-248627182 GGAAGACACAAGGACCAGGAAGG + Intergenic
1066032193 10:31439967-31439989 GGAAGACAAAGGTGGCAGCACGG + Intronic
1068048264 10:51915466-51915488 GGAAGACACAAGTGAAATGAGGG - Intronic
1070026780 10:72639428-72639450 GGAAGACGGAATTGCCAGTAAGG - Intergenic
1070433030 10:76360286-76360308 GGAAGTCAGAAATGCCACTAGGG - Intronic
1071699314 10:87912757-87912779 ACTAAACACAAGTGCCAGTAAGG - Intronic
1072622604 10:97090020-97090042 GACAGACACATGTGCCAGCAGGG - Intronic
1073038267 10:100579574-100579596 GGAAAAAAGAAGTGCCAGTGTGG + Intergenic
1074548714 10:114423348-114423370 GGAAGAAAAAAGTGCAACTAGGG - Intergenic
1075861834 10:125683765-125683787 GGATGCCACAAGTCCCAGCAAGG + Intergenic
1078693512 11:13605857-13605879 GGAAGACACAAGTGACAGAATGG - Intergenic
1081168061 11:39830900-39830922 AGAAGAGAGAAGTGCCAGTAAGG - Intergenic
1083326075 11:61873679-61873701 GGAAGACAACAGTACCAGGAGGG + Exonic
1084053299 11:66615226-66615248 GGAAGAGTCAAGAGCCAGTATGG - Intergenic
1084323669 11:68387049-68387071 GGATGACAGTAGTGACAGTAAGG + Intronic
1085705987 11:78787106-78787128 GGAGGACACCAGGGCCAGGATGG + Intronic
1086431750 11:86742973-86742995 GGGAGACACCATTCCCAGTATGG - Intergenic
1089279523 11:117363521-117363543 GGCTGACACATGTGCCTGTAGGG - Intronic
1089624453 11:119742421-119742443 GGAGGAGACAAGAGCTAGTAGGG - Intergenic
1091563955 12:1634247-1634269 AGAAGAGACAAGTGCCAGGTGGG - Intronic
1093312535 12:17608088-17608110 GTAAAACACAAGAGACAGTAAGG + Intergenic
1097737915 12:63202852-63202874 GGTAGACATAAGTTCTAGTATGG + Intergenic
1098056916 12:66516919-66516941 AGATGACAGAACTGCCAGTATGG - Intronic
1103439401 12:120951577-120951599 GGAAGACAGAACTCCCAGCAGGG + Intergenic
1104461714 12:128961975-128961997 GTAGGACACAAGTGTCAGGAAGG - Intronic
1104516680 12:129433560-129433582 GGAAGAAAGAAGTACCAGCAAGG - Intronic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1110600946 13:77373112-77373134 GGAAGGCACTAGGGCTAGTAAGG - Intergenic
1110818043 13:79882866-79882888 AGAAGACACAAGTGGCTGGATGG - Intergenic
1112449653 13:99497352-99497374 GGAAGAAACAAATGCCATTTAGG + Intergenic
1112854918 13:103756841-103756863 TGAAGACAAAAGTGCCACAAAGG + Intergenic
1114548240 14:23518096-23518118 GAAACACACCAGTGCCAGCAAGG - Intergenic
1116186679 14:41607419-41607441 GGAACACAGAAGGGCCAGCAGGG - Intergenic
1117325800 14:54667959-54667981 GGAAGACAACTGTGCCAGGAAGG - Intronic
1120421326 14:84289928-84289950 GGAAGACACAAATAACTGTAAGG - Intergenic
1121638563 14:95470196-95470218 TGAAGACCCAAGGGCCAGTGTGG + Intronic
1123939026 15:25207865-25207887 GGAGGACACATGTCCAAGTAAGG - Intergenic
1125876687 15:43154148-43154170 GGAACACACATGTGTCAGTCAGG + Intronic
1127930709 15:63595503-63595525 GGAAGGCACAAGTACCACTCTGG + Intergenic
1128444436 15:67744891-67744913 GGCAGCCACAAGTACCAGTTAGG - Intronic
1128507016 15:68279922-68279944 AGAAGACACGAAAGCCAGTAAGG - Intronic
1128553703 15:68615676-68615698 GGAAGACACAAGGGCCTCTCAGG - Intronic
1129035855 15:72648037-72648059 GGAAGACTCAAGTGTCTGTATGG + Intergenic
1129214030 15:74089179-74089201 GGAAGACTCAAGTGTCTGTATGG - Intergenic
1129399982 15:75276184-75276206 GGAAGACTCAAGTGTCTGTATGG + Intronic
1129472912 15:75765105-75765127 GGAAGACTCATGTGTCTGTATGG - Intergenic
1131262662 15:90895815-90895837 AGAAGGCACAAGTGCCGGTATGG + Intergenic
1131719632 15:95153766-95153788 GGAAGACTCTAGTGTCAGTCTGG + Intergenic
1137492552 16:48945031-48945053 GGAAGGAAGAAGTGTCAGTAGGG - Intergenic
1143374383 17:6458660-6458682 AGAAAAGACAAGTGTCAGTAAGG - Intronic
1143404788 17:6670102-6670124 GGAAGACAGGAGTGTCTGTATGG + Intergenic
1143881067 17:10030520-10030542 AGAAGCCACAAGAGCCAGGAGGG + Intronic
1144202252 17:12952193-12952215 GGAGGACACAGATGCCAGTCAGG - Intronic
1144280212 17:13719091-13719113 TGAAGACAGAAATGCAAGTATGG + Intergenic
1144995862 17:19268059-19268081 GGGAGACACACCTGCCACTAAGG - Intronic
1145795218 17:27651498-27651520 GGAAGACCCAAGTGGCCGTTGGG + Intergenic
1146756703 17:35439031-35439053 CGAAGACATAGGTGCCAGCAGGG + Exonic
1147896297 17:43753595-43753617 GGAAGACATAATTGCCACAAGGG + Intergenic
1148063835 17:44854419-44854441 AGAAGACAGATGTGCCTGTAAGG + Intronic
1149273647 17:55011857-55011879 GGAAAACCCAAGTGCCATTGAGG + Intronic
1150329994 17:64286829-64286851 GGAACACAGCAGGGCCAGTAGGG + Intergenic
1152203192 17:78958965-78958987 GAAAGATACAACTGCCAGGAGGG - Intergenic
1152334933 17:79695406-79695428 GGATGACACAAGTGCTTGAAAGG - Intergenic
1153712075 18:7809869-7809891 AGAAGACACAAGTGCCTTAAGGG + Intronic
1154188796 18:12210016-12210038 GGAAGAAATAAGAGACAGTAAGG - Intergenic
1155716237 18:28947367-28947389 GAAAGACACAAGGCCCAGTGAGG + Intergenic
1157329864 18:46695971-46695993 GGAAGTGGCAAGTGCCAGGAAGG + Intronic
1158015255 18:52775699-52775721 AGAAGACACAAGTGGCTGGATGG - Intronic
1164576295 19:29407240-29407262 AGGAGAGACAAGTGCCAGGATGG - Intergenic
1166752724 19:45172378-45172400 GGCAGACACAAGAGACAGGAAGG - Intronic
1167165821 19:47799176-47799198 GGAAGACACAGGGGCCAGGATGG + Intergenic
1167168249 19:47813865-47813887 GGGAGACCCAGGTGCCAGGACGG + Intronic
1168032032 19:53687992-53688014 GGAATACACAAGTACCAGTTGGG - Intergenic
1168036642 19:53724955-53724977 GGAACACACAAATACCAGTGGGG - Intergenic
1168487553 19:56777320-56777342 GGAAAACAGAAGAGCCAGTGAGG - Intronic
928913841 2:36450299-36450321 GGGAGAAACAAGTGCAAATATGG - Intronic
929793882 2:45043567-45043589 GGAAGAAAGAAGAGACAGTAAGG - Intergenic
930019131 2:46990471-46990493 AGAGGACACAAGTGCCTGCAGGG - Intronic
933651802 2:84855786-84855808 GGGAGACCCAAGTCCCAGTTGGG + Intronic
936403477 2:112183348-112183370 CTAAGACATAAGTGCCTGTAAGG - Intronic
937316947 2:120937662-120937684 GGCAGACACCAGTGCCACTAAGG + Intronic
939018713 2:136932931-136932953 GGAAGGCACCAGAGGCAGTAGGG + Intronic
939544330 2:143534211-143534233 GGAAGAAAGAAGTGCCAGTGAGG - Intronic
940070200 2:149678422-149678444 GAAAGATACAAGTGCAAGTAAGG + Intergenic
940344880 2:152619006-152619028 AGAAGCCACAACTGGCAGTATGG - Exonic
943717632 2:191169746-191169768 GGAAGAGACAAGTCACAGTATGG + Intergenic
946709847 2:222494525-222494547 TGAAGACACAAGTGCAAGTTGGG - Intronic
948092272 2:235304099-235304121 GGGAAAGAAAAGTGCCAGTAGGG - Intergenic
1177374898 21:20257508-20257530 AGAAGACACAAGTGCAAAAAGGG + Intergenic
1179261024 21:39758209-39758231 GGAACACACAACTGCCAGAAGGG + Intronic
1180138477 21:45876461-45876483 GGCAGACAAAGGTGCCAGTGGGG - Intronic
1180253399 21:46605280-46605302 GGAAGAAAAAAGGGCCTGTAGGG + Intergenic
1180353462 22:11821994-11822016 GGAAGACAGAAGGGCCATGAGGG - Intergenic
1180384779 22:12170363-12170385 GGAAGACAGAAGGGCCATGAGGG + Intergenic
1181099057 22:20526836-20526858 GGAAGACAACAGTCCCAGTCTGG - Intronic
1181106709 22:20579946-20579968 TGAAGACACAACTGGCATTAGGG - Intronic
1182280806 22:29216899-29216921 GGCAGCCACAAGGGCCAGTGTGG + Intronic
1183448594 22:37877436-37877458 CTAAGACAGAGGTGCCAGTAAGG + Intronic
949940257 3:9149264-9149286 GGAAGACACATGTGCCAGATGGG - Intronic
950110856 3:10417714-10417736 GGAAGACAGGAGTGTCAGGAAGG + Intronic
960334277 3:116397099-116397121 GGAAGCCATAAGTGCCATTTGGG - Intronic
961626315 3:128266343-128266365 GCAAGACATGGGTGCCAGTAGGG - Intronic
963274455 3:143316298-143316320 TGAAGACACAAGTGTAATTACGG + Intronic
963694548 3:148548855-148548877 GGAAGTCGCAGGTGGCAGTAAGG - Intergenic
967347004 3:188468648-188468670 TGGAGACTCAAGTGCCAGGAAGG + Intronic
968074303 3:195808142-195808164 GGCCGACACAAGTGCCATTCCGG + Intronic
969924107 4:10569468-10569490 CCAAGACCAAAGTGCCAGTAGGG - Intronic
975855340 4:78618336-78618358 GGAAGACCCAGGTGCCAGGAAGG + Intergenic
978437007 4:108696343-108696365 GGATGACGCAAGTGACAGCAAGG + Intergenic
982144821 4:152374763-152374785 GGATGAAACCAGTGCCAGAAGGG + Intronic
983455781 4:167962396-167962418 GGAAGACACAATTTTCAGAATGG + Intergenic
983501784 4:168507622-168507644 GGAAGACAAGACTGACAGTAGGG - Intronic
984363057 4:178762007-178762029 GGAAGACCCAAGAACAAGTAGGG + Intergenic
985520225 5:370705-370727 GGAAGGCACAGGTGACAGTGTGG + Intronic
986321651 5:6636753-6636775 GGAAGACTTACGTGCCAGTGAGG + Intronic
987326872 5:16820341-16820363 GGAAGACGCAAGTACCTGTCTGG - Intronic
989761824 5:45024514-45024536 GAAAGACAAAAATGCCAGTTGGG - Intergenic
994584694 5:101691600-101691622 AGAAGACAAAAGTGTCAATATGG - Intergenic
996580144 5:125023003-125023025 GTGAGACACAATTTCCAGTAAGG + Intergenic
997432180 5:133848162-133848184 GGAGGAGGAAAGTGCCAGTAGGG + Intergenic
1003647555 6:7926409-7926431 GGGAGACACACCTCCCAGTAGGG + Intronic
1007200775 6:40106707-40106729 GGAAGACACAAGGACCCTTAAGG + Intergenic
1008255726 6:49297497-49297519 GGAGCACACAGGTGCCAGCAGGG + Intergenic
1008628217 6:53338283-53338305 GGATGTGACAAGTGACAGTAAGG - Intronic
1012768586 6:103400175-103400197 GGAATACAGTAGTGCCATTATGG + Intergenic
1012802051 6:103842982-103843004 GGAAGGGAAAAGTGCCAGAAGGG + Intergenic
1013070723 6:106726930-106726952 TCAAGACCAAAGTGCCAGTAAGG + Intergenic
1015561354 6:134519476-134519498 GGAAGGCACATTAGCCAGTAGGG + Intergenic
1016444240 6:144116667-144116689 GGAAAACCCAAGTGCTATTAGGG + Intergenic
1016932082 6:149421638-149421660 GGAAGACCAAAGTACCAGGATGG - Intergenic
1018907465 6:168083794-168083816 GGAAGACAGCAGAGCCAGGAGGG + Intergenic
1022101132 7:27169743-27169765 GGAAGCCACAGGCCCCAGTAAGG + Intronic
1023166606 7:37349406-37349428 GGAAGACAGCAGTGCCAAGAGGG - Intronic
1023977210 7:45039400-45039422 GGTAAACCCAAGGGCCAGTAGGG - Intronic
1024011909 7:45274314-45274336 GGAAGACAGAAGTCCCAGGAAGG - Intergenic
1027406814 7:77871258-77871280 GGAATACACAAGATCCATTAAGG - Intronic
1028305625 7:89260075-89260097 TGAAGACACAAGCCCCAGTAAGG - Intronic
1028591877 7:92505545-92505567 GGAAAACATAAGTGAGAGTAAGG + Intronic
1028618401 7:92797107-92797129 GAAAGACACAACTGGCAGCATGG + Intronic
1031743571 7:125466583-125466605 GGTAGACACAAAAGTCAGTAAGG - Intergenic
1032735915 7:134692442-134692464 GAAAGACACAAGGGCCATGATGG - Intergenic
1034694213 7:153039661-153039683 GGAAGCCACAAATGTCACTATGG + Intergenic
1035116139 7:156525811-156525833 GGAAGACATAAGTACTAGGAAGG + Intergenic
1036556377 8:9863630-9863652 GGAAGACAGAAGTGACAGTGGGG - Intergenic
1043925104 8:86027878-86027900 GGATGAGACAAGTAGCAGTACGG - Intronic
1045682204 8:104674376-104674398 GGAAGACACAAGTGCCAGTAAGG - Intronic
1046629315 8:116607770-116607792 GGAAAACAGGAGTGGCAGTAGGG - Intergenic
1052053711 9:23880336-23880358 GGAAGACACAATTTACAGAATGG - Intergenic
1052380911 9:27770104-27770126 TGAAGACCCAACTCCCAGTAGGG + Intergenic
1052859979 9:33431719-33431741 GGAAGACAGAAGAGACAGAAAGG + Intergenic
1054847508 9:69812117-69812139 GGAATTCACAAGTGCTAGTCTGG - Intergenic
1060407490 9:123379998-123380020 GGAAGAGCCATGTGCCAGGATGG + Exonic
1060539879 9:124422088-124422110 GGGAGACACAATTGCCTGGAGGG + Intergenic
1060781861 9:126418859-126418881 GGAAGACTCAAGTGCTAGGAAGG - Intronic
1187490050 X:19743002-19743024 TGCAGACACAAGTGCCCCTAAGG + Intronic
1189746950 X:44178732-44178754 GGAAGGCACCAATGCCAGAATGG + Intronic
1190050958 X:47147870-47147892 GGAAGACTCCAGGGACAGTATGG + Intronic
1190528069 X:51347901-51347923 AGGAGACAGAAGTGCCAGCAGGG + Intergenic
1190602597 X:52108072-52108094 GGATGACACAAGTACCTCTATGG + Intergenic
1193194747 X:78619066-78619088 GGAGGACACAAGTGCCTCTGGGG + Intergenic