ID: 1045683222

View in Genome Browser
Species Human (GRCh38)
Location 8:104684770-104684792
Sequence CTTCTTGCTGTGTCATCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4177
Summary {0: 4, 1: 89, 2: 311, 3: 1232, 4: 2541}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045683220_1045683222 -4 Left 1045683220 8:104684751-104684773 CCTGGCATCTTGTGAGGGCCTTC 0: 2
1: 2
2: 12
3: 39
4: 170
Right 1045683222 8:104684770-104684792 CTTCTTGCTGTGTCATCCTATGG 0: 4
1: 89
2: 311
3: 1232
4: 2541
1045683219_1045683222 -3 Left 1045683219 8:104684750-104684772 CCCTGGCATCTTGTGAGGGCCTT 0: 1
1: 0
2: 1
3: 51
4: 159
Right 1045683222 8:104684770-104684792 CTTCTTGCTGTGTCATCCTATGG 0: 4
1: 89
2: 311
3: 1232
4: 2541
1045683216_1045683222 9 Left 1045683216 8:104684738-104684760 CCAAGAGCATGGCCCTGGCATCT 0: 2
1: 58
2: 140
3: 275
4: 705
Right 1045683222 8:104684770-104684792 CTTCTTGCTGTGTCATCCTATGG 0: 4
1: 89
2: 311
3: 1232
4: 2541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045683222 Original CRISPR CTTCTTGCTGTGTCATCCTA TGG Intronic
Too many off-targets to display for this crispr