ID: 1045683604

View in Genome Browser
Species Human (GRCh38)
Location 8:104688693-104688715
Sequence CACACTGCTCAGAAAGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045683604_1045683607 5 Left 1045683604 8:104688693-104688715 CCCTATGCTTTCTGAGCAGTGTG 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1045683607 8:104688721-104688743 AGAGAACTAGCTTAATATTATGG No data
1045683604_1045683608 13 Left 1045683604 8:104688693-104688715 CCCTATGCTTTCTGAGCAGTGTG 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1045683608 8:104688729-104688751 AGCTTAATATTATGGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045683604 Original CRISPR CACACTGCTCAGAAAGCATA GGG (reversed) Intronic
900785873 1:4650175-4650197 CACAGTTATGAGAAAGCATAAGG + Intergenic
901777001 1:11567022-11567044 CCCACTTCTCAAAAAGCTTAAGG + Intergenic
903333506 1:22609592-22609614 CACAGTGCACAGAAAGCACTTGG - Intergenic
903512796 1:23889052-23889074 ACCACTGTTCAGAAACCATATGG + Intronic
905294401 1:36945071-36945093 CACACTGTTCATTAAGCAAATGG + Intronic
905937106 1:41833478-41833500 AACAATGCTCAGAAAGGCTAAGG + Intronic
906971363 1:50518299-50518321 CATACTGCTCAGAAATAAAAAGG - Intronic
907776928 1:57524911-57524933 AAAACTGCTCACAAAGAATATGG + Intronic
907942829 1:59105770-59105792 CTCACTGCTCAGAAATCTGAAGG - Intergenic
908063120 1:60372867-60372889 CACACTTATCACAAAGCAAATGG - Intergenic
908146464 1:61250016-61250038 AAAAGTGCACAGAAAGCATATGG + Intronic
908223587 1:62033738-62033760 GAAACAGCTCAGAAAGCATGGGG + Intronic
908317734 1:62949895-62949917 GAAACTGCTGAGAAAGCAGATGG + Intergenic
908820574 1:68081834-68081856 CATAATGCTCAGAAATCCTATGG + Intergenic
909902101 1:81150573-81150595 AACACTGCTCATAAAACATTAGG + Intergenic
910404667 1:86874492-86874514 CACACTGCTCAGAATGTCAAGGG + Intronic
911359719 1:96862119-96862141 CACACTGCTCAGGAACCAGAGGG - Intergenic
912236958 1:107862718-107862740 AACACAGCTCAGATAGGATACGG + Intronic
913978216 1:143482724-143482746 CAGACTGATCAGAAATCATCTGG + Intergenic
915787602 1:158632975-158632997 GACACTGCTCAGAAATAAGAAGG + Intronic
916850488 1:168698171-168698193 CACTCTGCTCAAACAGCCTAAGG + Intronic
917390336 1:174529734-174529756 CAAACTGCTCAGGAACCAGAGGG - Intronic
918732481 1:188015290-188015312 GAAACTGATCAGAAAGTATAAGG + Intergenic
921135698 1:212257204-212257226 CAGACTGCCCAGAAACCATGGGG + Intergenic
922719417 1:227892745-227892767 CACCCAGCTCAGAAAGGAGATGG + Intergenic
923823976 1:237478539-237478561 CACACTGCTAAGATATGATATGG + Intronic
924093362 1:240525207-240525229 GACACAGCTCAGAAATCTTAAGG - Intronic
1063141087 10:3257212-3257234 CAAAATCATCAGAAAGCATAAGG - Intergenic
1063257133 10:4340693-4340715 CCCACTGCTTAGAAACCAAAGGG + Intergenic
1065250850 10:23811843-23811865 TCCACATCTCAGAAAGCATATGG - Intronic
1071669461 10:87594852-87594874 CAAAGTGCTCAGAAAGCTTGAGG - Intergenic
1073073890 10:100811430-100811452 CCCACTGCTGAGATGGCATATGG - Intronic
1073346079 10:102783939-102783961 CACACTGCTTAGAAGGCAGCAGG - Intronic
1074754120 10:116611716-116611738 CACATTGTTCAGAATGCACATGG + Intergenic
1078828826 11:14958740-14958762 CACCCTTCTCAAAAAGCAAAAGG - Intronic
1080578606 11:33623038-33623060 CTGACTGCTCACAAAGCTTATGG + Intronic
1081103690 11:39037233-39037255 CATACTATTCAGAAAACATAAGG + Intergenic
1081880434 11:46445953-46445975 CACAGTACTCAAAAAGCATCTGG - Intronic
1082203143 11:49398171-49398193 GTTACTGCTCAGAAACCATAAGG + Intergenic
1085759614 11:79230715-79230737 CACAGGGCTCAGAAAACATGAGG - Intronic
1087474989 11:98623469-98623491 CCCACTGCTCAAAAACCCTAGGG + Intergenic
1088533244 11:110833298-110833320 AACTATGCTCAGAAAGAATATGG + Intergenic
1090232310 11:125116923-125116945 CTTACTTCTCAGAAAGTATATGG + Intergenic
1092071124 12:5632103-5632125 CACACAGCTCAGGGAGCAGAAGG + Intronic
1099259377 12:80358050-80358072 CACTGTGCTTGGAAAGCATAAGG + Intronic
1100458471 12:94775759-94775781 AACACTGTTCAGAAAGCAAATGG + Intergenic
1102015442 12:109645108-109645130 CTCCCAGCTCAGAAAGCATTAGG - Intergenic
1102194311 12:111013560-111013582 CTCACTCCTCAGACAGGATAAGG + Intergenic
1103144051 12:118578859-118578881 TCCACAGCTCAGCAAGCATATGG + Intergenic
1103189970 12:118992892-118992914 CACACTGCTCAGAATTCCTTGGG + Intronic
1105221132 13:18328734-18328756 CAGACTGATCAGAAATCATCTGG - Intergenic
1105270547 13:18870773-18870795 CATAGTGCACAGCAAGCATAAGG + Intergenic
1105511551 13:21056077-21056099 CACAATGCTCAGTACACATATGG - Intronic
1108726551 13:53189328-53189350 CCTACTGCTCAAAAAGCAGAGGG + Intergenic
1109987497 13:70009234-70009256 CACACTGCAATGAAATCATAGGG + Intronic
1110745158 13:79043895-79043917 CACACAGCTCTGAAAGCCAATGG - Intergenic
1111256921 13:85682567-85682589 CTCAGTGCTCAGAAAGCTCAGGG - Intergenic
1111946309 13:94669201-94669223 CACACTTCCCCCAAAGCATATGG + Intergenic
1111947471 13:94681082-94681104 CACACTGAACAGAAAACACAAGG + Intergenic
1113743242 13:112725279-112725301 CACTCTGCTCCCAAAGCATTTGG - Intronic
1115000163 14:28412253-28412275 CACACTGCTGATACAGCATCTGG - Intergenic
1115461783 14:33669258-33669280 CACAGTGCTGAGAAGGCAAAAGG - Intronic
1116555750 14:46304595-46304617 CACACAATTCAGAAAGCAGAGGG - Intergenic
1117158567 14:52964933-52964955 CACACTACTAAAAAAGCATGTGG - Intergenic
1117297772 14:54394738-54394760 CACACTGCCCCGCAAGCAGAGGG + Intergenic
1117442571 14:55773709-55773731 CACAGTGGTCTGAAAGCAGAAGG - Intergenic
1117988061 14:61408045-61408067 CACACTGCCCAGTAAACACATGG - Intronic
1118340623 14:64893908-64893930 TCCACAGCTCAGCAAGCATATGG + Intergenic
1119791351 14:77352770-77352792 CATATTCCTCAGAAAGCAGATGG + Intronic
1120071960 14:80113558-80113580 CACACTGCTCAGTGATCCTAGGG + Intergenic
1124154287 15:27211671-27211693 CACACTGCACAGAATGCTTAGGG - Intronic
1124260561 15:28185967-28185989 CACAGTGCTCAGATAAAATAAGG + Intronic
1124986486 15:34621293-34621315 CACACTGCTAAGAAGTGATAGGG - Intergenic
1126387749 15:48111274-48111296 CACACAGCCTAAAAAGCATATGG + Intergenic
1132816320 16:1828997-1829019 CACAGTGCTCAGAAGGCCAAAGG - Intronic
1133396219 16:5449553-5449575 TAGACTGCACAGAAAGCATGGGG - Intergenic
1133645976 16:7765025-7765047 CACCCAACTCACAAAGCATATGG + Intergenic
1138280755 16:55770794-55770816 CTCACTGATGAGAAAGCCTAGGG + Intergenic
1140254349 16:73322118-73322140 CACACAGCTCGGAGAGCAGAGGG + Intergenic
1141690275 16:85592856-85592878 CACACTGCTCCGAATGCTTAGGG - Intergenic
1142668952 17:1478579-1478601 CACACTGCTCCCAAGGCAGAAGG - Intronic
1143328942 17:6120139-6120161 CACACTGCTCAGCCACCAAAGGG + Intronic
1144752095 17:17655980-17656002 CAGGCTGGTCAGAAAGCACAGGG + Intergenic
1146559477 17:33855713-33855735 CACAATCCTCAGAATGCATCAGG - Intronic
1147358215 17:39913989-39914011 TACACTGCTCAAGAAGCAAATGG - Intronic
1148884665 17:50763390-50763412 CACACTGCTCAGAAAGGTAAGGG - Intergenic
1149151416 17:53568714-53568736 CAAACTGGTCAGAAATCATTCGG + Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150491575 17:65577824-65577846 GACAGTGCTCAGAAAGGGTAAGG + Intronic
1151577904 17:74962155-74962177 CGCACAGCTCAGAAAGCCCATGG - Intronic
1154299927 18:13184132-13184154 CACAGAGCTCAGAATGCATGCGG + Intergenic
1156477706 18:37416636-37416658 CACACTGCTCAGCCAGCCTGGGG + Intronic
1157278917 18:46333268-46333290 CACACTGCCCAGAAAACCCAGGG - Intronic
1157619358 18:49007184-49007206 CACACTACTCAGCTAGCACAAGG + Intergenic
1157698345 18:49743250-49743272 CAAACTGCCCAGAAAACATCTGG - Intergenic
1162058986 19:8083337-8083359 CACACAGGTGAGCAAGCATACGG + Exonic
1162219104 19:9160963-9160985 CACACTGGAGAGAAACCATACGG + Exonic
1163919669 19:20276722-20276744 CACATGTCTCAGGAAGCATAGGG - Intergenic
1166721629 19:45000419-45000441 CACACAGCTCAGGATGTATACGG + Intergenic
924992172 2:321668-321690 CACACTTCCCTGAAAGCAAATGG - Intergenic
925062882 2:906379-906401 CACACTAGTTAGAAAGAATATGG - Intergenic
925414433 2:3659558-3659580 CACAGTGCTCAGACAGCCTGTGG - Intronic
925685329 2:6465846-6465868 GATACTGCTCTGAAAACATAAGG - Intergenic
926316174 2:11711892-11711914 CACACTGCTCTGAGAGCCTCAGG + Intronic
927041511 2:19235372-19235394 CTCACTGCTCTGAAAGTACAGGG + Intergenic
932970536 2:76535535-76535557 CACAGAGCTCAGAAAGCCTGAGG + Intergenic
933727051 2:85433085-85433107 CACCCTGCTCTGAAAGGAAAAGG - Intronic
934182923 2:89643732-89643754 CAGACTGATCAGAAATCATCTGG + Intergenic
934293212 2:91717921-91717943 CAGACTGATCAGAAATCATCTGG + Intergenic
934579020 2:95423517-95423539 CACATTGCTCACCAAGCCTATGG + Intergenic
934600427 2:95653186-95653208 CACATTGCTCACCAAGCCTATGG - Intergenic
935431264 2:102978342-102978364 CACGTTGCTCAGAGGGCATATGG + Intergenic
936533788 2:113295249-113295271 CACATTGCTCACCAAGCATATGG - Intergenic
937680714 2:124641204-124641226 AACACTGAATAGAAAGCATAGGG - Intronic
938936924 2:136135301-136135323 CAGAGTGCTCAGCAAGCATTTGG - Intergenic
945703287 2:213198581-213198603 CACACTGGGCACAAAGCATGAGG - Intergenic
946047238 2:216831398-216831420 CACACTGCTCAGGACGGATGAGG + Intergenic
948866055 2:240775420-240775442 CTCACTGCTCAGAACTCAGACGG + Intronic
1171358651 20:24570140-24570162 AACACTGCTCTGAAAATATATGG + Intronic
1174913676 20:54633219-54633241 CCCAGGGCCCAGAAAGCATAGGG + Intronic
1177322575 21:19542387-19542409 CAAACTGCACAGAAAACACACGG - Intergenic
1181566599 22:23742582-23742604 CCCACTGCTCAGAAACCAGACGG + Exonic
951104766 3:18730046-18730068 CACACAGCTCTGATTGCATAGGG - Intergenic
955457003 3:59133648-59133670 GACACAGCACAGAAAGCAGAAGG + Intergenic
956669518 3:71673126-71673148 CAAACTGCTGAAAATGCATAAGG + Intergenic
958450112 3:94262353-94262375 ATCACTGCTCAGAAAGAAAAGGG - Intergenic
960666249 3:120111824-120111846 CACACTTCTCAAAAAGCAAGAGG + Intergenic
962949972 3:140209341-140209363 CCCACTGTCCTGAAAGCATAAGG - Intronic
965147116 3:164921103-164921125 CTCACTGTCTAGAAAGCATAAGG + Intergenic
970885861 4:20986921-20986943 GAGACAGCTCAGAAAGCATGTGG - Intronic
971752859 4:30673869-30673891 CCCATTACTCAGAAAGCAAAGGG - Intergenic
973300362 4:48575707-48575729 CACACTTCTCAGAACCCAAAAGG - Intronic
975889177 4:79004403-79004425 CAAACTGCTCAAAAAGTAAATGG - Intergenic
976665190 4:87582953-87582975 CTAACTGCTCTGAAAGCACAGGG - Intergenic
977314076 4:95423289-95423311 CATGCTGCCCAGAAAGCACAGGG + Intronic
979532673 4:121785672-121785694 CACACTGCTCGGAAAGAAGTAGG - Intergenic
979549709 4:121977214-121977236 CACACTGCTCACAATGCCTTGGG + Intergenic
984574534 4:181432459-181432481 CACAATGCTCAGCAAGGAGAGGG - Intergenic
986897675 5:12389990-12390012 CACTGTGTTCAGAAAGAATACGG - Intergenic
989817425 5:45752896-45752918 CACACTGCTCAGACACCAAGAGG - Intergenic
994044600 5:95293792-95293814 CAATCTGGTCAGAAAGCATCAGG - Intergenic
996351216 5:122544049-122544071 CACTGTGCTTAGACAGCATAAGG - Intergenic
997792645 5:136775049-136775071 CACAATTCTGAGAAAGCATCTGG + Intergenic
998246033 5:140506247-140506269 CCCATTCCTCAGAAAGTATATGG - Intronic
999432557 5:151536714-151536736 AACACAGGTGAGAAAGCATATGG - Intronic
1003790069 6:9536227-9536249 CACACTGCACAGAAAGATGATGG - Intergenic
1004206604 6:13597297-13597319 CCCAGTGTACAGAAAGCATAGGG + Intronic
1007547817 6:42707821-42707843 CACACTGCCCAGAGACCACATGG + Intronic
1008407015 6:51129706-51129728 CAAACTGCTCAGAGCCCATATGG + Intergenic
1009787305 6:68356573-68356595 CACTCTACTTAGAAGGCATAGGG - Intergenic
1010273971 6:73948244-73948266 CACACTGCTCAGGACCCAGAGGG - Intergenic
1012657975 6:101849650-101849672 CACACTGCTCAGAAAATAGAAGG + Intronic
1015168223 6:130222960-130222982 CACAGTACACAGGAAGCATAAGG + Intronic
1015782933 6:136890033-136890055 CACAGTTCCCAGAGAGCATAAGG + Intronic
1016011837 6:139144890-139144912 CACATGGCTCAGAAAGCACTGGG - Intronic
1016271794 6:142298793-142298815 CACAATGCTGAGAAATCACAGGG + Intergenic
1016379576 6:143461148-143461170 CACAGTTCTAAGAAAGCATTGGG + Intronic
1016762753 6:147757425-147757447 CAAACTGCTCAGAAAGAATGAGG - Intergenic
1018881488 6:167886774-167886796 GACACAGCTCAGAAAGCATCAGG - Intronic
1026190912 7:68125983-68126005 TACACATCTCAGAAAGGATATGG + Intergenic
1029227517 7:99038801-99038823 CACACTGCTTACAAAGCAGCTGG - Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033593220 7:142832393-142832415 CACACTGCACAGGCAGCATCTGG + Intergenic
1035047116 7:155974736-155974758 CACACTGGGAAGAAAGCAAAGGG + Intergenic
1035119558 7:156555027-156555049 CACACTGCTCAGCAATAAAAAGG + Intergenic
1036760738 8:11507066-11507088 CACACTGCTCTGTCAGCAGATGG - Intronic
1039233236 8:35472559-35472581 CACACTTATCAGAAGGGATATGG + Intronic
1039720347 8:40157557-40157579 CAGAATGCTCTGGAAGCATAAGG + Intergenic
1041148354 8:54904037-54904059 TACACCTCTCAGTAAGCATATGG + Intergenic
1041289403 8:56294447-56294469 CACAAAGCTGAGAAAGAATATGG - Intergenic
1042799454 8:72702907-72702929 CGCAGTGCACAGAAAGCAGATGG - Intronic
1042966135 8:74354759-74354781 CAAACAGCTCAGAATGCAGAGGG - Intronic
1043869301 8:85413600-85413622 CACACTGCCCAGAATTCAAAAGG + Intronic
1045231684 8:100312193-100312215 AACACTGCTCTAAAAGCAGAGGG - Intronic
1045683604 8:104688693-104688715 CACACTGCTCAGAAAGCATAGGG - Intronic
1047367527 8:124225542-124225564 CCCAGTGCTCAGAAAGTATGGGG - Intergenic
1051401647 9:16690171-16690193 CTCACTGATCAGAAAGCAACTGG + Intronic
1051835395 9:21331870-21331892 CACACAGCTCAGGATGCACATGG + Exonic
1057902937 9:98963670-98963692 CACATTGCTCAGAAAGAGTGTGG + Intronic
1059932839 9:119278319-119278341 TTCACTGCTCAGAAAGATTAAGG - Intronic
1062656977 9:137608797-137608819 CACACTCCTCAGTAAGAACACGG - Intronic
1186227266 X:7413060-7413082 CAGACTGCCCAGAAACCATGCGG - Intergenic
1186403250 X:9278812-9278834 CACACTGCTCACAATGACTATGG + Intergenic
1188836955 X:34969826-34969848 CAAATTACTCAGAAAGCACATGG - Intergenic
1189643290 X:43098091-43098113 CAGACTGCCCAGAAAGTATAGGG - Intergenic
1194746428 X:97633526-97633548 CACAGTGCTCAGTAAACATTTGG - Intergenic
1196368609 X:114950531-114950553 CAACCTGCTCAGAAAGGAAAGGG + Intergenic