ID: 1045690390

View in Genome Browser
Species Human (GRCh38)
Location 8:104754165-104754187
Sequence ACCAAAAATGTCTCCAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 7, 2: 39, 3: 118, 4: 421}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045690390_1045690397 5 Left 1045690390 8:104754165-104754187 CCCAGCCTGGAGACATTTTTGGT 0: 1
1: 7
2: 39
3: 118
4: 421
Right 1045690397 8:104754193-104754215 ACCAGCTGGAGGGGTGCTACTGG No data
1045690390_1045690393 -9 Left 1045690390 8:104754165-104754187 CCCAGCCTGGAGACATTTTTGGT 0: 1
1: 7
2: 39
3: 118
4: 421
Right 1045690393 8:104754179-104754201 ATTTTTGGTTGTTAACCAGCTGG No data
1045690390_1045690399 6 Left 1045690390 8:104754165-104754187 CCCAGCCTGGAGACATTTTTGGT 0: 1
1: 7
2: 39
3: 118
4: 421
Right 1045690399 8:104754194-104754216 CCAGCTGGAGGGGTGCTACTGGG No data
1045690390_1045690401 16 Left 1045690390 8:104754165-104754187 CCCAGCCTGGAGACATTTTTGGT 0: 1
1: 7
2: 39
3: 118
4: 421
Right 1045690401 8:104754204-104754226 GGGTGCTACTGGGAACTAGTGGG No data
1045690390_1045690395 -5 Left 1045690390 8:104754165-104754187 CCCAGCCTGGAGACATTTTTGGT 0: 1
1: 7
2: 39
3: 118
4: 421
Right 1045690395 8:104754183-104754205 TTGGTTGTTAACCAGCTGGAGGG No data
1045690390_1045690394 -6 Left 1045690390 8:104754165-104754187 CCCAGCCTGGAGACATTTTTGGT 0: 1
1: 7
2: 39
3: 118
4: 421
Right 1045690394 8:104754182-104754204 TTTGGTTGTTAACCAGCTGGAGG No data
1045690390_1045690400 15 Left 1045690390 8:104754165-104754187 CCCAGCCTGGAGACATTTTTGGT 0: 1
1: 7
2: 39
3: 118
4: 421
Right 1045690400 8:104754203-104754225 GGGGTGCTACTGGGAACTAGTGG No data
1045690390_1045690402 23 Left 1045690390 8:104754165-104754187 CCCAGCCTGGAGACATTTTTGGT 0: 1
1: 7
2: 39
3: 118
4: 421
Right 1045690402 8:104754211-104754233 ACTGGGAACTAGTGGGTTTGAGG No data
1045690390_1045690396 -4 Left 1045690390 8:104754165-104754187 CCCAGCCTGGAGACATTTTTGGT 0: 1
1: 7
2: 39
3: 118
4: 421
Right 1045690396 8:104754184-104754206 TGGTTGTTAACCAGCTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045690390 Original CRISPR ACCAAAAATGTCTCCAGGCT GGG (reversed) Intronic
900724764 1:4208688-4208710 ACAAAAAATGTCTCCAGGAGAGG + Intergenic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
900936647 1:5770291-5770313 ACCCAAAAGATCTCCAGGGTGGG + Intergenic
901591505 1:10347798-10347820 AGCAAAAATGTCCCCTGGCAAGG - Exonic
901777164 1:11568121-11568143 ACAAAAAAATTATCCAGGCTTGG - Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902039114 1:13480047-13480069 ATCAAAACTGTCTCCAGTCCGGG + Intronic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902176384 1:14653988-14654010 ACCAAAAATATCTCCAGGCCAGG + Intronic
903523375 1:23972735-23972757 AAAAAAAAAGACTCCAGGCTGGG - Intronic
904141469 1:28357030-28357052 ACAAAAATTGTTTCCAGGCTGGG + Intergenic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
905127044 1:35722924-35722946 AACAAAACTGGCTACAGGCTGGG - Intronic
905302744 1:36996892-36996914 ACCAAAAATGTCTTCCGTCATGG - Intronic
905352859 1:37359541-37359563 ACCGGAAATGTCTCCAGTCATGG + Intergenic
905747737 1:40433643-40433665 GCCAAAAATTTCTCCAGGTTTGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907094495 1:51764878-51764900 AATAAAAATGAATCCAGGCTAGG - Intronic
907211502 1:52827693-52827715 ATTAAAAATGTCTGCAGGCTGGG - Intergenic
907364616 1:53947576-53947598 ACCAAAAGTGTCTGCAGCCTTGG + Intronic
907413289 1:54297332-54297354 ATAAAAACTGTCTCAAGGCTGGG + Intronic
909237818 1:73175921-73175943 AGCAAAAAATTATCCAGGCTTGG - Intergenic
909779303 1:79522501-79522523 ACAAAAAATGTGTCCAGGCTGGG + Intergenic
910293736 1:85623742-85623764 ACCAAGAATGTGGCCAGGCATGG + Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911146378 1:94556098-94556120 ACCCCAGCTGTCTCCAGGCTTGG - Intergenic
911583347 1:99660728-99660750 ACCAAAAAATTATCCAGGCATGG + Intronic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
914045787 1:144091074-144091096 ACAAAAAAAGTCTATAGGCTGGG + Intergenic
914132323 1:144869613-144869635 ACAAAAAAAGTCTATAGGCTGGG - Intergenic
914202256 1:145496064-145496086 ATCAAAAATGTCTACAGGCTGGG + Intergenic
914236186 1:145813979-145814001 ATCAAAAATGTCTACAGGCTGGG + Intronic
914481382 1:148069206-148069228 ATCAAAAATGTCTACAGGCTGGG + Intergenic
914872224 1:151484670-151484692 AAAAAACATGTCTTCAGGCTGGG + Intergenic
915236540 1:154487554-154487576 AACGAAACTGACTCCAGGCTGGG + Intronic
915329599 1:155102145-155102167 ACAAAAAAGTTCTCCAGGCATGG + Intergenic
915409575 1:155689589-155689611 TCCAAACATGCCTCCAGGGTTGG + Intronic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916775811 1:167962967-167962989 AACAAAAATGTTGCCAGGCGTGG + Intronic
918308715 1:183270177-183270199 ACCAAAAAAGTTTCAAGGCCAGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918491938 1:185090218-185090240 ACTAAAAATTTCACCAGCCTCGG - Intronic
918921985 1:190724297-190724319 ACAAAAAATCAATCCAGGCTGGG - Intergenic
920555442 1:206900812-206900834 AGAAAAGATGTCTCCAGGTTAGG - Intronic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
922965604 1:229688546-229688568 ACCAATAATGTCTCCAGCTCTGG + Intergenic
924252228 1:242144204-242144226 AACCAAAATTTCTGCAGGCTGGG + Intronic
924252237 1:242144280-242144302 AACCAAAATTTCTGCAGGCTGGG + Intronic
1063631968 10:7742443-7742465 AAAAAATATATCTCCAGGCTGGG + Intronic
1063673662 10:8120381-8120403 ACAAAAAATGTAGCCAGGCGTGG - Intergenic
1066691975 10:38038253-38038275 ACAAAAAAGTTATCCAGGCTTGG - Intronic
1068406067 10:56590580-56590602 AACTAAAATGTCTTCAGACTTGG + Intergenic
1068790924 10:61030236-61030258 CAGAAAAATGGCTCCAGGCTGGG + Intergenic
1069480535 10:68777774-68777796 ATAAAAAATGTATCCGGGCTTGG + Intronic
1069520660 10:69117570-69117592 ATCAAAACTGTCTCCAGGCCGGG + Intergenic
1069572814 10:69504663-69504685 ACCAAGAATTCCCCCAGGCTGGG + Intronic
1071210506 10:83336683-83336705 ACCAAAAAATTATCCAGGCGTGG + Intergenic
1071251250 10:83822202-83822224 ACCAAAAAAATAGCCAGGCTTGG + Intergenic
1072346532 10:94513257-94513279 AAAAAAAGTGTCCCCAGGCTGGG + Intronic
1073879783 10:107967545-107967567 ACAAAAAAGTTATCCAGGCTTGG - Intergenic
1074117917 10:110471465-110471487 AAAAAAAATGTTTCTAGGCTGGG - Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074665626 10:115720013-115720035 ACAAAAAATATATCCAGGCCTGG - Intronic
1074838258 10:117322088-117322110 CCCAAAAACATCTCCAGGTTGGG + Intronic
1075170016 10:120104470-120104492 ACCAAAAATGTCTCTATCCCTGG - Intergenic
1075505239 10:123015517-123015539 ACCCAAAATGTCTCCATCCATGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1077597846 11:3549476-3549498 AAAAAAAAAGTATCCAGGCTTGG - Intergenic
1077991887 11:7419557-7419579 AACAAAAATGTCTCAAGGCGGGG + Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1080322799 11:31033843-31033865 AGTAAAAATGTCTACAGGCCGGG + Intronic
1080903373 11:36516475-36516497 ACAAAAAAATTCTCCAGGCGTGG - Intronic
1080905367 11:36539638-36539660 ACTAAAAATATCGCCAGGCGTGG - Intronic
1081521641 11:43887461-43887483 ACGAAAAAAGTAGCCAGGCTTGG - Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083194204 11:61073232-61073254 AGTAAGAATGTGTCCAGGCTTGG - Intergenic
1083244674 11:61417220-61417242 ACAAAACATGTCTCCAATCTGGG + Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084177469 11:67430727-67430749 ATCAAAAATGTGTCCATGCCAGG - Intronic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084376932 11:68784023-68784045 ACCAAAAAATTAGCCAGGCTTGG - Intronic
1084490229 11:69474499-69474521 TCCAACAATGTCTCTAGGGTGGG + Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085931581 11:81089553-81089575 ACCAAGTCTGTGTCCAGGCTGGG - Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1088468123 11:110163942-110163964 ACAAAAAAATTCACCAGGCTTGG + Intronic
1088615275 11:111620382-111620404 ACCAAAAATTTCTCCATTTTTGG - Exonic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089195829 11:116693537-116693559 ACCAAATACTTCTCCAGGCAGGG - Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1091390457 12:123107-123129 ATCAAAGATGTCTAGAGGCTGGG + Intronic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092812334 12:12283593-12283615 ACCTAAAATGTCTCTGGACTTGG - Intergenic
1093175996 12:15914083-15914105 CTCAAAAATGTCTTGAGGCTGGG + Intronic
1093323703 12:17746162-17746184 ACAAAAAAATTCTCCAGGCTTGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1094548764 12:31429998-31430020 AACAAAAAAGTATTCAGGCTGGG - Intronic
1095611543 12:44134370-44134392 ACCAAAAAATTAGCCAGGCTTGG - Intronic
1095706624 12:45243843-45243865 ACTAAAAATTTATTCAGGCTGGG - Intronic
1097789915 12:63804146-63804168 ATCAAAAACGTCTCCAGGCCAGG - Intronic
1097792497 12:63829686-63829708 ACCAAAGAAGTAGCCAGGCTTGG + Intergenic
1098311821 12:69156482-69156504 ACCAAAAATCTCTCCTGGCCAGG + Intergenic
1098815420 12:75155146-75155168 GCCAAAAATTTCTGCAGGCATGG - Intronic
1099682774 12:85848980-85849002 AACAAAAATTTATCCAGGCATGG - Intergenic
1100161926 12:91870804-91870826 CATAAAAATGTGTCCAGGCTGGG - Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101317116 12:103639405-103639427 CTCAAAAATGTTTCCAGGCTGGG + Intronic
1101779331 12:107821685-107821707 AACAAAAATGTGGCCAGGCGTGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1102596502 12:113996821-113996843 ATAAAAAATGTCTCCAGGCCAGG + Intergenic
1102644537 12:114395657-114395679 ACCAGAATTATCTCCACGCTTGG + Intronic
1102795176 12:115683083-115683105 TTAAAAAATGTCTCCAAGCTGGG - Intergenic
1103106800 12:118234532-118234554 ACAAAAAAAGACTCCAGGCGCGG - Intronic
1103287146 12:119812099-119812121 ACAAAAAAAGTATCCAGGCATGG - Intronic
1103722861 12:122983884-122983906 ACCAAAAATGTTTACAGAGTTGG - Exonic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1105855407 13:24367309-24367331 TGCAAAAAGGTCTCCAGTCTAGG + Intergenic
1106657645 13:31763379-31763401 ACCAAAAGTGTCTCCAGGCTGGG - Intronic
1107371016 13:39748317-39748339 TCAAAAAATATCTCCAGGCTGGG + Intronic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107463182 13:40624731-40624753 ACCAAAAATGATTCCAGGTTGGG - Intronic
1108300816 13:49073896-49073918 ACCAAAAATGTTTCCAATTTGGG - Intronic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1109406709 13:61909718-61909740 ACCAAAAGTGTCACCAGCCTGGG - Intergenic
1109416659 13:62049707-62049729 ACAAAAAATGTAGCCAGGCATGG + Intergenic
1111519490 13:89381725-89381747 ATCACAAATGTCTTCAGGTTAGG - Intergenic
1111742731 13:92224961-92224983 CCCAAGACTGCCTCCAGGCTTGG - Intronic
1112018834 13:95353993-95354015 ACCAAAAATGTGTCCAGGCTGGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112501706 13:99947923-99947945 GTCAAAAATGTCTCCAGGCTGGG - Intergenic
1112903756 13:104391840-104391862 AACAAAAATCTCTCTAGGTTTGG - Intergenic
1113971094 13:114189845-114189867 ATAAAGAATATCTCCAGGCTGGG + Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115439113 14:33411476-33411498 AACAAAAATGCCTCCAGGCCGGG - Intronic
1116155893 14:41205423-41205445 AGCAAGGCTGTCTCCAGGCTTGG - Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1116456476 14:45126052-45126074 ACCAAAAAAGTAGCCAGGCGTGG - Intronic
1116569388 14:46496425-46496447 ACAAAAACTATCTCCAGCCTAGG - Intergenic
1116892470 14:50282133-50282155 ATTAAAAATGTCTCTAGGCTAGG - Intronic
1117975170 14:61290001-61290023 AGGAAAAATGTGTCCAGGCACGG + Intronic
1117983420 14:61364166-61364188 CCTAAAAGTGTCTCCAGGCCAGG - Intronic
1119075807 14:71637576-71637598 AAAAAAAAAGTATCCAGGCTTGG + Intronic
1119856201 14:77903047-77903069 AGCAAAATTGTCCCCTGGCTGGG + Intronic
1119884697 14:78130382-78130404 ACCAGAGATGTCTCAAGGATTGG + Intergenic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120493172 14:85202464-85202486 CCCAAAAATGCCTCCAGGTTTGG - Intergenic
1124783927 15:32661322-32661344 ACAGAAAATGTCTCCAGGCCAGG + Intronic
1124946052 15:34267551-34267573 GTCAGAGATGTCTCCAGGCTGGG + Intronic
1124951963 15:34331434-34331456 TCAAAAAATGCCTCTAGGCTGGG - Intronic
1125064122 15:35461366-35461388 AACAAAAATGTATTCTGGCTGGG - Intronic
1125292681 15:38167033-38167055 ACAAAAAATTTAGCCAGGCTTGG + Intergenic
1125387654 15:39155255-39155277 ACAAAAAAAGTAGCCAGGCTTGG + Intergenic
1126022996 15:44420446-44420468 AGCAAGACTGTCTCCAGGCCGGG - Intergenic
1126296141 15:47137192-47137214 TCCAAAAATATCTCCAGTTTAGG + Intergenic
1127511916 15:59650931-59650953 ACAAAAGATGTCTTCAAGCTTGG - Intronic
1127830148 15:62743457-62743479 CCCAAAAACGTACCCAGGCTCGG - Intronic
1129506485 15:76085749-76085771 TACAAAAATGTCCACAGGCTGGG + Intronic
1129904386 15:79175932-79175954 ATCAAAAATATCTCCAGGTGTGG - Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130191904 15:81745143-81745165 ACAAAAAGTATCTCCAGGCCAGG - Intergenic
1130288601 15:82576725-82576747 ATAAAAACTGACTCCAGGCTGGG + Intronic
1130519704 15:84653183-84653205 ACAAAAAAAGTCTTCAGGCTGGG - Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131091927 15:89629975-89629997 ACCAAAAGTATCTCCAGCCATGG + Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131530164 15:93184063-93184085 ATAAAAAATGTCTCTCGGCTGGG + Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133374269 16:5271196-5271218 AAAAAAAAAGTATCCAGGCTTGG + Intergenic
1133399790 16:5477222-5477244 ACCAAAAATATCTTCAGCCTGGG - Intergenic
1133514092 16:6490737-6490759 TCCTAAACTGTCTCCAGGCTGGG - Intronic
1133605362 16:7381923-7381945 CCCAAAGATGTCTCTAGACTTGG + Intronic
1133742794 16:8663986-8664008 ACCAAAACTGTCTCCAGCTGTGG + Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134805452 16:17120328-17120350 ACCAGAAAGGTCTCCAGGACAGG - Intronic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134853848 16:17503638-17503660 GCAAAAAAAGTATCCAGGCTGGG - Intergenic
1134856560 16:17524797-17524819 ACAAAAAAAGGCACCAGGCTCGG - Intergenic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135232816 16:20725675-20725697 ATCAAAAATGTCCCTAGGCTGGG + Intronic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1136368052 16:29818329-29818351 ATCAAGAATGGCTCTAGGCTGGG - Intronic
1137262909 16:46845489-46845511 AACAAAAATGTGGCCAGGCACGG + Intergenic
1137382462 16:48011978-48012000 ACCAACACTTCCTCCAGGCTCGG - Intergenic
1138213324 16:55181169-55181191 ATGAAAAATGTTTCCAGGCCAGG + Intergenic
1138969111 16:62123576-62123598 ATCAAAAAAGTATCCAGGCATGG - Intergenic
1139407976 16:66734704-66734726 ACCCAAAATGTGGCCAGGCGTGG + Intronic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141052848 16:80787876-80787898 AGCAAATATGTCTGCATGCTTGG - Intronic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141521991 16:84586738-84586760 ACCAAAAAAGTAGCCAGGCATGG - Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1142320420 16:89378943-89378965 CCCAAAAAGGTCTTCAGCCTTGG - Intronic
1142321217 16:89384233-89384255 AACAAACATTTCTCAAGGCTGGG + Intronic
1142869966 17:2813664-2813686 AATGAAAATGTCTCCAGGCCAGG + Intronic
1143232737 17:5371120-5371142 AACAAAAAATTCTCCAGGCGTGG - Intronic
1143317837 17:6046080-6046102 AACCAAAATATCTCCAGGCATGG - Intronic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146700554 17:34955954-34955976 TTCAAAAATGTCTTCAAGCTAGG + Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1146907623 17:36627969-36627991 TTCAAAAATATGTCCAGGCTGGG - Intergenic
1146940831 17:36843303-36843325 TCCAATATTGGCTCCAGGCTGGG + Intergenic
1147013696 17:37473113-37473135 AAAAAAAATTTCTCCAGGTTTGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1148832768 17:50445497-50445519 ATCAAAAGTGTCTACAGGCTGGG + Intronic
1149754607 17:59176547-59176569 ACCAGAAATGTCTGCTTGCTGGG + Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151603776 17:75123602-75123624 AAAAATAATGTCTTCAGGCTGGG - Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153937277 18:9939721-9939743 ACCAAAAATGTTTCCAAGCACGG - Intronic
1154196664 18:12271934-12271956 TCCCTAAATGTCTCCAGTCTTGG - Intronic
1155775346 18:29754193-29754215 AACAGAAATCTCTCCAGCCTGGG - Intergenic
1157693597 18:49703154-49703176 ACAAAAATTCTCACCAGGCTGGG + Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158335305 18:56409965-56409987 CCTAAAAATGTCTCAAGTCTTGG + Intergenic
1158701812 18:59755089-59755111 TCCTAAAATGTCTCCACTCTTGG + Intergenic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1159398161 18:67891860-67891882 ACAGAAAATGTGTGCAGGCTTGG - Intergenic
1160012940 18:75120304-75120326 TTAAAAAATGTTTCCAGGCTGGG - Intergenic
1161121215 19:2527810-2527832 AGCACAAATGTCCCCAGACTTGG + Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161444056 19:4308112-4308134 ACCAAGAAAGTGTCCAGGCCGGG + Intronic
1161520507 19:4721064-4721086 ACCAAAAATGTCCCCTGGGGGGG - Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161878950 19:6933680-6933702 ACCAAAAATGTCTTCTGGTCGGG - Intronic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162780434 19:13004063-13004085 ACCAAAAATGATTCCAGGTTGGG - Intronic
1162969821 19:14173962-14173984 AAAAAAAGAGTCTCCAGGCTTGG + Intronic
1163002113 19:14375122-14375144 CCCAAAAGTGTCCCCAGTCTTGG - Intergenic
1163283103 19:16329217-16329239 ACCAAAAATGTTCCCAGACTGGG - Intergenic
1163317199 19:16548978-16549000 CTCAAAAATGGCTTCAGGCTGGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163454804 19:17400248-17400270 ATTAAAAATGTTTCCAGGCTGGG - Intergenic
1164296374 19:23914151-23914173 ACCATAAATATCTAGAGGCTAGG - Intergenic
1164460079 19:28439352-28439374 ACCTAGAATGTCTCCAGGCATGG - Intergenic
1165501961 19:36196676-36196698 TTCAAAAATGAGTCCAGGCTGGG + Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1166646370 19:44534746-44534768 ACAATAAATGCCTCCAGACTTGG + Intergenic
1167057452 19:47120989-47121011 AAAAAAAATGTCCCCAGGCTGGG - Intronic
1167111096 19:47461864-47461886 ACTAAGAATGTGTCCAGCCTGGG + Intronic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1202685346 1_KI270712v1_random:44485-44507 ACAAAAAAAGTCTATAGGCTGGG + Intergenic
926144159 2:10386658-10386680 ACCACAAAGGTCTGCAGGCTGGG + Intronic
927952245 2:27179773-27179795 ACAAAAAAATTATCCAGGCTAGG - Intergenic
928809930 2:35211341-35211363 ACAAAAAATGTAGCCAGGCGTGG - Intergenic
929180762 2:39036504-39036526 ACAAAAAATGTAACCAGGCGCGG - Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
929656916 2:43742295-43742317 AAAAAAAATGTCTTCAGGCCAGG - Intronic
929880169 2:45829651-45829673 ACCCTAAAGGGCTCCAGGCTTGG + Intronic
930062954 2:47305998-47306020 ACAAAAAATTTCTTCAGGCCAGG + Intergenic
930841345 2:55849910-55849932 AACATAAATTTCTCCAGCCTGGG - Intergenic
931339662 2:61387307-61387329 ACAAAAAATTTAGCCAGGCTTGG + Intronic
932264316 2:70353832-70353854 AGAATAAATTTCTCCAGGCTGGG - Intergenic
934050839 2:88209527-88209549 ACCAAGCATTTCTCCAGTCTTGG + Intergenic
934141656 2:89052998-89053020 ACAATGAATGACTCCAGGCTTGG - Intergenic
934227587 2:90147548-90147570 ACAATGAATGACTCCAGGCTTGG + Intergenic
934246379 2:90310347-90310369 ACAAAAAAAGTCTATAGGCTGGG - Intergenic
934315219 2:91911725-91911747 CCAAAAAATATTTCCAGGCTGGG - Intergenic
935671829 2:105562556-105562578 ATCAAAAATGTCTTCAGGCGGGG + Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938001933 2:127749045-127749067 ACCAAAAATGTGGCCGGGCTTGG + Intronic
938045816 2:128118958-128118980 ACCAAAAATGAGGCCAGGCGCGG - Intronic
939472051 2:142635035-142635057 AGCCAAAATGTCTCAGGGCTGGG + Intergenic
939530552 2:143355085-143355107 ACCTAAACTGTCTCCAGTTTTGG + Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941324172 2:164092656-164092678 AACAAAAATTTCTAGAGGCTGGG + Intergenic
941650490 2:168087260-168087282 ACCAAATATGGCTCCAGGCAGGG + Intronic
942021256 2:171868138-171868160 ATGAAAAATGTATTCAGGCTGGG - Intronic
942821668 2:180122573-180122595 CCCAATAATGTCTCCACACTTGG - Intergenic
943437310 2:187882179-187882201 ACCAAAAAAGTGTCTGGGCTTGG - Intergenic
943708540 2:191062208-191062230 ATAAAAAATGTATCCAGGCATGG - Intronic
946763890 2:223022259-223022281 ACCAAACATGTCTCCAGGCCGGG + Intergenic
947071673 2:226294477-226294499 GCCAAAACTGTCTCCAGATTTGG - Intergenic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948563182 2:238867286-238867308 CCCCAAGATGTCTCCAGGCTAGG - Intronic
1169170144 20:3458172-3458194 GTCAAAAATGTCTTGAGGCTGGG + Intergenic
1170210463 20:13841927-13841949 ATCAAAAAAGTTGCCAGGCTGGG - Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1171946133 20:31379211-31379233 TAAAAAAATGTGTCCAGGCTGGG - Intronic
1172207840 20:33177056-33177078 GCCAAAAATGTATTGAGGCTGGG + Intronic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173038237 20:39433699-39433721 GCAATAAATGTGTCCAGGCTTGG + Intergenic
1173612788 20:44382871-44382893 TTCAAACATTTCTCCAGGCTGGG + Intronic
1173985078 20:47254829-47254851 AATAAAAATATCTCCAGGCCAGG + Intronic
1174177551 20:48654526-48654548 AACAAAAATGTCTCCGGGCAGGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1174613498 20:51818213-51818235 ACAAAAAAAGTAGCCAGGCTTGG - Intergenic
1174755372 20:53153231-53153253 AGCATAAATGTCCCCAGCCTGGG + Intronic
1174851273 20:53997756-53997778 ACCTAAAACGTATCCGGGCTGGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1175629286 20:60519686-60519708 CCCAAATATGTCTCCAGCCTTGG + Intergenic
1176251404 20:64122248-64122270 ACAAAAAATGTAGCCAGGCGTGG + Intergenic
1176289561 21:5036922-5036944 ACCCAAAATGCCTCCAGACCTGG - Intronic
1176648826 21:9527932-9527954 ACAAAAAAAGTGTCCAGGCGTGG + Intergenic
1178107822 21:29339929-29339951 ACAAAAAATCTTTACAGGCTGGG - Intronic
1178491214 21:33053243-33053265 ACCTAATATATCTCCAGTCTGGG - Intergenic
1178838945 21:36123049-36123071 ACCAAAAATTTAGCCAGGCTTGG + Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179058993 21:37962474-37962496 TCTAAAAATGTCTCCCGGCCAGG + Intronic
1179143623 21:38748905-38748927 AGCAAAAATGACTGCAGGCAAGG - Intergenic
1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG + Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1182029405 22:27145876-27145898 TACAAAAAAGTGTCCAGGCTTGG + Intergenic
1182593106 22:31397459-31397481 AAAAAAAAAGTATCCAGGCTGGG - Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1184017589 22:41797857-41797879 ACCAAAAACAGCTCCTGGCTTGG + Intronic
1184588132 22:45461552-45461574 ACCAAAAAATTATCCAGGCATGG + Intergenic
1185059696 22:48599857-48599879 GCCACAGATGCCTCCAGGCTGGG + Intronic
949228328 3:1720500-1720522 ACCAAGTATGTCTCCAAGGTGGG + Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
955243814 3:57205111-57205133 TCAAAAAATGGCTCCTGGCTGGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
957987993 3:87595922-87595944 GCCAAAATTGCCTCCAGACTAGG + Intergenic
959742982 3:109742376-109742398 ACCTAAAATGTCTCAAAGATCGG - Intergenic
960086315 3:113595275-113595297 ACTAAAAATGCCTCCAGGCTTGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
960932457 3:122867684-122867706 AATAAAAATGTATTCAGGCTAGG + Intronic
961154279 3:124665757-124665779 TCTAAAAATGACTCCAGGGTGGG - Intronic
961285153 3:125796126-125796148 AAAAAAAAAGTATCCAGGCTTGG + Intergenic
961739429 3:129023753-129023775 ACCAAAAATGTCTGCAGCTTAGG + Intronic
961805531 3:129486828-129486850 ACCCAAAAAGTCACCAGCCTAGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962308756 3:134311426-134311448 ACTAAAAAGGACTCTAGGCTGGG + Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964302354 3:155302820-155302842 ACAAAAAATTTCTCCAAACTTGG + Intergenic
965416550 3:168401891-168401913 ACAAAAAATTTAGCCAGGCTTGG - Intergenic
967042716 3:185708409-185708431 ACCAAAAACATCTCCAGGAAGGG + Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969318710 4:6397315-6397337 ACCAAAAATCACCCCAGGCCAGG + Intronic
969326107 4:6444887-6444909 TCCAAAAACCTCTCCAGCCTGGG + Intronic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
972424252 4:38917835-38917857 ATCACAAAAATCTCCAGGCTAGG - Intronic
972783881 4:42309445-42309467 GCCAGAAATGTCTCCCAGCTGGG + Intergenic
973043834 4:45510137-45510159 ACCAAAAAATTAGCCAGGCTTGG + Intergenic
973074092 4:45901028-45901050 ACCACAACTGGCACCAGGCTGGG - Intergenic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
973747643 4:53980129-53980151 GTCAAAAATTTCTTCAGGCTGGG + Intronic
975330684 4:73109001-73109023 ACCAAAAATTTATCTAGGCTGGG + Intronic
975338390 4:73208031-73208053 ACAAAAAAATTCTCCAGGCGTGG + Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
977593642 4:98853868-98853890 ACTAAATATGTCAACAGGCTGGG + Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
979161116 4:117462704-117462726 ATTTAAAATGTCTTCAGGCTGGG + Intergenic
979185180 4:117780619-117780641 GCCACTGATGTCTCCAGGCTAGG - Intergenic
982729502 4:158940856-158940878 AGCAAAAATCTCTCCAAGTTTGG + Intronic
983221191 4:165045967-165045989 AGTAGAAATGTCTCCAGGCCTGG - Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983830010 4:172314761-172314783 ACAAAAAATTTAGCCAGGCTTGG - Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
986158574 5:5201702-5201724 ACCCAAGAAGTCCCCAGGCTAGG + Intronic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987040307 5:14055953-14055975 ATGAAAAATGTCTCCAGGTGGGG - Intergenic
987081343 5:14427777-14427799 ACCAAAAAGGCACCCAGGCTCGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988447584 5:31305093-31305115 ACCAAAAATGTTTCGTGTCTTGG + Intronic
988541786 5:32116684-32116706 ACCAAAAAATTAGCCAGGCTTGG + Intergenic
989023123 5:37033861-37033883 ATCAAAAATATATTCAGGCTGGG - Intronic
989228349 5:39056478-39056500 ACCAAAAAATTAGCCAGGCTTGG + Intronic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989639708 5:43571056-43571078 ACCAGAAACATCTACAGGCTAGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
990789361 5:59459478-59459500 AATCAAAATCTCTCCAGGCTGGG + Intronic
991053484 5:62297272-62297294 GCCACAAATGCCTCAAGGCTTGG + Intergenic
992633181 5:78701183-78701205 TTCAAAATTGTCTCTAGGCTGGG - Intronic
992918507 5:81485799-81485821 AACACAAATGTGTCCAGGCATGG - Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993869870 5:93239946-93239968 AACAACAATGACTGCAGGCTGGG - Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994883966 5:105534093-105534115 ACAAAAAATTTCGCCAGGCGTGG + Intergenic
997645668 5:135480185-135480207 ACCAAAAATGCCACCTGGCAAGG - Intergenic
997707751 5:135974479-135974501 ACAGAAGATGTTTCCAGGCTAGG - Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
997968528 5:138380856-138380878 AAAAAAAATCACTCCAGGCTGGG - Intronic
998110848 5:139501393-139501415 AAAAAAAAAGTCTACAGGCTTGG + Intergenic
998140915 5:139698946-139698968 ACCAACATTTTCACCAGGCTGGG - Intergenic
999588443 5:153117402-153117424 ACAAAAAATGGCTCCAGTATGGG - Intergenic
1000149263 5:158483724-158483746 AGGAAAAATGTCTCTACGCTGGG - Intergenic
1000281578 5:159786996-159787018 ACGAAAACAGTCCCCAGGCTGGG + Intergenic
1000563011 5:162814034-162814056 AGCCAAAGTATCTCCAGGCTGGG + Intergenic
1000768017 5:165316417-165316439 ACGAAATATGTCTGCTGGCTGGG - Intergenic
1000786038 5:165544916-165544938 AAAAAAAATATTTCCAGGCTGGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1001229069 5:169970303-169970325 ACCAAATAGGTATCCAGGTTTGG - Intronic
1001772966 5:174309556-174309578 ACCCATCATGTCGCCAGGCTTGG + Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003889216 6:10549050-10549072 ACCAAAAATGTCTTCACGCTGGG - Intronic
1004338055 6:14782712-14782734 ACTAAAAATGTGTCCAGAATTGG + Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1004625114 6:17367690-17367712 ACAAAAAATGCATCCAGTCTAGG - Intergenic
1004910342 6:20277085-20277107 CCCACAAATACCTCCAGGCTGGG + Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1005902297 6:30227359-30227381 ACCATAAATGTCTAGAGGCTAGG + Intergenic
1006593429 6:35175099-35175121 ACCAAAAAAGTAGCCAGGCATGG + Intergenic
1006705139 6:36013474-36013496 ATCAAAAATGTCTCCGGGCCAGG - Intronic
1006715458 6:36116374-36116396 ATAAAAAAGTTCTCCAGGCTGGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1006992698 6:38228901-38228923 ACAAAAACAGTCTCTAGGCTGGG + Intronic
1007109124 6:39302956-39302978 ACCTAAAATGTCTCCTCTCTGGG - Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008578861 6:52887118-52887140 ACCAAAAAATTATCCAGGCTTGG + Intronic
1008584856 6:52939212-52939234 AAAAAAAATGTATCAAGGCTGGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1010042150 6:71397450-71397472 AATAAAAAGGTCTCCAGCCTGGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1012446248 6:99310119-99310141 ACCAAAAAAGTCTACTGTCTAGG + Intronic
1013134905 6:107272691-107272713 ACTAAAAATGTGGCCAGGCGTGG + Intronic
1013553231 6:111230907-111230929 GCCAAAAATGGCCCCAGGGTAGG - Intronic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1017515942 6:155155768-155155790 AACAAAAACATTTCCAGGCTGGG - Intronic
1017944311 6:159081143-159081165 ACAAAAAATGTAGCCGGGCTTGG + Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1022170222 7:27820308-27820330 ACAAAAAATGTCTGCAGTTTAGG - Intronic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022370094 7:29762784-29762806 ACCAAAAAATTAGCCAGGCTTGG + Intergenic
1022411535 7:30142062-30142084 CCCAAAAATGTCTGTAGGGTTGG + Intronic
1022980858 7:35603567-35603589 TCTAAAAATGTCACCAGGGTGGG - Intergenic
1023296518 7:38720730-38720752 ATTAAAAATGACTCCAGGCCTGG - Intergenic
1023637092 7:42223081-42223103 CACAGAAATGACTCCAGGCTGGG + Intronic
1024171804 7:46795536-46795558 ACTAAACATGTATCCTGGCTGGG - Intergenic
1024382479 7:48713474-48713496 ACCAAAGTTGTCTCCAAGATTGG + Intergenic
1024544748 7:50507972-50507994 ACCAAATGTGACCCCAGGCTTGG + Intronic
1025213413 7:57034726-57034748 AAAAAAAATCTCTGCAGGCTGGG + Intergenic
1025658540 7:63542098-63542120 AAAAAAAATCTCTGCAGGCTGGG - Intergenic
1026031984 7:66802187-66802209 TTTAAAAATGTCTCCAGGCCTGG - Intronic
1026411319 7:70126126-70126148 ACCAAATATGTGGCCAGGCATGG + Intronic
1026555359 7:71403953-71403975 ATCAAATTTGTCTACAGGCTGGG - Intronic
1027242145 7:76337919-76337941 CCCAAGACTGCCTCCAGGCTTGG - Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028679945 7:93515409-93515431 ACCAAAAATGCATGCATGCTTGG + Intronic
1028898204 7:96065531-96065553 ACCAAAAATTTAGCCAGGCATGG - Intronic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029683762 7:102130851-102130873 AAAAAAAATCTCTGCAGGCTGGG + Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030209029 7:106978267-106978289 ACCAAAAATGTCTCCTGGAGTGG - Intergenic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031515279 7:122691830-122691852 CCCCAGAATGTCTCCAGGCATGG + Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032023206 7:128421532-128421554 ACCAACAAGGTCTCAAGGCCTGG - Intergenic
1032151316 7:129432625-129432647 ACCAAAAATGTCTCGGGGCGGGG - Intergenic
1032448322 7:132003743-132003765 ACCATAAATGTCTCAAGTGTAGG + Intergenic
1032572123 7:133011572-133011594 ACCTAAAAGGTCTCCAGGTATGG + Intronic
1034146416 7:148876880-148876902 ACCAAAAATGATCCCTGGCTGGG + Intronic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036429282 8:8674904-8674926 AACAAAAAAGTAGCCAGGCTTGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1038046085 8:23766539-23766561 ACCACAGATGTATCCAGGCTTGG + Intergenic
1038819980 8:30943392-30943414 CCCAAAAGAGTCTCAAGGCTTGG - Intergenic
1039342430 8:36665548-36665570 ACCACAAATGCATCCAGCCTAGG - Intergenic
1039383339 8:37106776-37106798 CCCATACATGTCTCCAGGATGGG + Intergenic
1039942395 8:42102372-42102394 ATAAGAAATGTCTCCAGGCCAGG + Intergenic
1040994836 8:53391044-53391066 ACCAAAAATATCTGCATCCTAGG - Intergenic
1041316006 8:56563177-56563199 AAAAAAAATCTTTCCAGGCTGGG + Intergenic
1041725905 8:61017134-61017156 CCCAAAAATCCCACCAGGCTCGG - Intergenic
1042653576 8:71069950-71069972 TCCAGAAAAGTCTCCAGGTTGGG - Intergenic
1043561966 8:81503470-81503492 ACCAAAAATGCCTCAAGATTTGG - Intergenic
1045399729 8:101801432-101801454 ACCAAAATTGGCTACATGCTGGG + Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046016415 8:108610639-108610661 AGAAAAAAAGTGTCCAGGCTGGG + Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1048807424 8:138253649-138253671 ACCAAACATGTCTCTGGGCATGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050349440 9:4725916-4725938 ACCCACAATATCTCCAGGGTAGG - Intronic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1050916971 9:11148475-11148497 TTCACAAATGTCTTCAGGCTGGG - Intergenic
1051083811 9:13323567-13323589 TCCAAAAAAGTCTCCAAGCCTGG + Intergenic
1051229527 9:14941059-14941081 TGCAAAAATATCTCCAGTCTGGG - Intergenic
1051637995 9:19198270-19198292 ACAAAAATTAACTCCAGGCTAGG + Intergenic
1051838392 9:21366103-21366125 ACCAAAAATTTGGCCAGGCATGG - Intergenic
1051925601 9:22321134-22321156 ATCAAAACTGTCTGCAGGTTTGG - Intergenic
1053208077 9:36204960-36204982 ATTAAAAATATCCCCAGGCTCGG - Intronic
1054849854 9:69836433-69836455 CGCAACAATGTCTCCAGGCATGG + Intronic
1055461932 9:76527824-76527846 AGCAAAAATGTGTCCAGAATTGG + Intergenic
1055506267 9:76952630-76952652 ACCAAAAATGTTTCTAGAGTGGG - Intergenic
1055590913 9:77813066-77813088 ACCAAAAAAGTAGCCAGGCGTGG - Intronic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1055992795 9:82125698-82125720 ACCAAAAATGGATTCATGCTGGG - Intergenic
1057633348 9:96739341-96739363 ACAGAAAATGTATACAGGCTGGG + Intergenic
1057636749 9:96776477-96776499 ATCAGAAACGTCTCCAGGCCGGG + Intronic
1058660896 9:107267899-107267921 AGAAAAGATGTATCCAGGCTGGG + Intergenic
1059701103 9:116775865-116775887 AACAAATATGTCTGAAGGCTTGG - Intronic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060070990 9:120547306-120547328 AACAAAAATATTTCCAGGCCGGG + Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061101100 9:128493087-128493109 ACAAAAAAACTCTCCTGGCTGGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1062431058 9:136527055-136527077 CTCAAAACTTTCTCCAGGCTCGG - Intronic
1062686744 9:137817548-137817570 CCCAGAAATGACACCAGGCTTGG - Intronic
1203626562 Un_KI270750v1:31481-31503 ACAAAAAAAGTGTCCAGGCGTGG + Intergenic
1185646924 X:1622578-1622600 TTTAAAAATGTCTCCTGGCTGGG - Intronic
1185744696 X:2563361-2563383 ACAAAAAATGTAGCCAGGCATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185808017 X:3078475-3078497 ACAAAAAAAGTCACCAGGTTGGG - Intronic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186524914 X:10239459-10239481 ACCACAAAAGTTTCCAGGCATGG - Intergenic
1186682969 X:11895280-11895302 AACAAAGATGTTTCCAGGCATGG + Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187911911 X:24119122-24119144 ACAAAAAATGTGTCTAGGCTGGG - Intergenic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190363548 X:49671093-49671115 ACCAAAAATGTCTCTACGCTGGG + Intergenic
1190720608 X:53144398-53144420 ACAAAAAATCTGTCTAGGCTGGG + Intergenic
1191593957 X:62922430-62922452 ACAAAAAATTTAACCAGGCTTGG + Intergenic
1191751030 X:64542915-64542937 ACAAAAAATGTGGCCAGGTTTGG + Intergenic
1192570418 X:72199237-72199259 AAAAACAATGTCTCTAGGCTGGG + Intronic
1194670015 X:96720257-96720279 TACAAAAATCTCTCCAGCCTTGG + Intronic
1195012150 X:100743153-100743175 ACCAAAAATGTCCCCTGGGCAGG - Intergenic
1195275340 X:103275867-103275889 ACCAAAAATGTTACCGGGTTTGG - Intronic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196009141 X:110867742-110867764 AAGAAAAATATCTCAAGGCTTGG - Intergenic
1196124800 X:112085656-112085678 ACCAAAAATGCGTCCAGGCATGG + Intergenic
1196710310 X:118755242-118755264 TCAAAAAATGACTCCAGGCCAGG - Intronic
1198142522 X:133818943-133818965 ACCAAAAGGGTCTCCAGTCTAGG - Intronic
1198391400 X:136178908-136178930 ACCAAAAAATTATCCAGGCCTGG - Intronic
1198536346 X:137590490-137590512 ACAAAAATTGTCTCAAGGCCAGG + Intergenic
1199114486 X:143975005-143975027 AACATAAATGTCACCAGCCTTGG - Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199749778 X:150804454-150804476 AACAAAGATCTCTCCAGGCACGG + Intronic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201595390 Y:15662509-15662531 AACGAAAATTTCTTCAGGCTAGG - Intergenic
1202262634 Y:22985608-22985630 AACAAAAATGTCTCAACACTGGG - Intronic
1202415624 Y:24619349-24619371 AACAAAAATGTCTCAACACTGGG - Intronic
1202455163 Y:25050737-25050759 AACAAAAATGTCTCAACACTGGG + Intronic
1202588283 Y:26455137-26455159 ACAAAAAAAGTCTATAGGCTGGG - Intergenic