ID: 1045696402

View in Genome Browser
Species Human (GRCh38)
Location 8:104813389-104813411
Sequence GTTTCAAAGGAGAGATAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045696396_1045696402 22 Left 1045696396 8:104813344-104813366 CCATTAGGCTTTCTGAAGTACAT 0: 1
1: 0
2: 2
3: 18
4: 292
Right 1045696402 8:104813389-104813411 GTTTCAAAGGAGAGATAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045696402 Original CRISPR GTTTCAAAGGAGAGATAGGG CGG Intronic
No off target data available for this crispr