ID: 1045696771

View in Genome Browser
Species Human (GRCh38)
Location 8:104817876-104817898
Sequence ATTCTCCTTTGGGGAATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045696763_1045696771 29 Left 1045696763 8:104817824-104817846 CCCAGCCCTGAATGAGTATACTG 0: 1
1: 0
2: 0
3: 14
4: 112
Right 1045696771 8:104817876-104817898 ATTCTCCTTTGGGGAATCAAAGG No data
1045696765_1045696771 24 Left 1045696765 8:104817829-104817851 CCCTGAATGAGTATACTGAATTG 0: 1
1: 0
2: 1
3: 14
4: 107
Right 1045696771 8:104817876-104817898 ATTCTCCTTTGGGGAATCAAAGG No data
1045696766_1045696771 23 Left 1045696766 8:104817830-104817852 CCTGAATGAGTATACTGAATTGT 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1045696771 8:104817876-104817898 ATTCTCCTTTGGGGAATCAAAGG No data
1045696764_1045696771 28 Left 1045696764 8:104817825-104817847 CCAGCCCTGAATGAGTATACTGA 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1045696771 8:104817876-104817898 ATTCTCCTTTGGGGAATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045696771 Original CRISPR ATTCTCCTTTGGGGAATCAA AGG Intronic
No off target data available for this crispr