ID: 1045698086

View in Genome Browser
Species Human (GRCh38)
Location 8:104833986-104834008
Sequence CAGCAGAAGGAGAAGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1109
Summary {0: 1, 1: 0, 2: 9, 3: 124, 4: 975}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045698086 Original CRISPR CAGCAGAAGGAGAAGGAACA TGG (reversed) Intronic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900020918 1:186316-186338 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900361383 1:2290664-2290686 CAGGAGGAGGAGGAGGAAGAGGG + Intronic
900813842 1:4828266-4828288 CAGCCCAAGGAGGAGGAAAAAGG - Intergenic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
901484480 1:9549116-9549138 CAGCAGGATGAGAAGGGACTGGG + Intronic
902407316 1:16191829-16191851 CCGCAGAAGGAGGAGGAAGCTGG - Intergenic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902762284 1:18590028-18590050 CACCAGGAGGAGAAGGAGGAGGG - Intergenic
903134332 1:21299478-21299500 CAGCAGAAGGAACAGGAATAGGG + Intronic
903370515 1:22832152-22832174 CAGCAGGAATAGCAGGAACAGGG + Intronic
903401451 1:23053946-23053968 CAGCACAAGGTGAAATAACATGG - Intronic
903549919 1:24150688-24150710 CAGCAGTAGGAGGAGGAGGAGGG + Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903581268 1:24372788-24372810 CAGAAGCAGGAGGAGGAGCAGGG - Intronic
903663533 1:24993230-24993252 CAGCAGGAGGAGGTGGAGCAGGG - Intergenic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904582726 1:31558539-31558561 TAGCAGAAGGACAAAGGACAGGG - Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905488003 1:38320055-38320077 TACCAGAAGGAGAAGAAAGAGGG - Intergenic
905701087 1:40014983-40015005 CCACAGAAGGAGAAAGAGCATGG + Intergenic
905793676 1:40803423-40803445 CAGCAGAGGGAGAAGCAGAAGGG - Intronic
905873855 1:41419709-41419731 CAGCAGAAGGAGCAGGAGCTGGG - Intergenic
905914682 1:41676421-41676443 CAGGAGAAGGTGGAAGAACAGGG + Intronic
905972652 1:42153491-42153513 CAGCAGCAGCAGGAGGACCACGG - Exonic
906105640 1:43290508-43290530 CAGAAGGAAGAGAAGGGACAAGG + Intergenic
906149098 1:43577454-43577476 CAGCTGGAGGTGAAGGAAGAGGG - Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906592171 1:47035597-47035619 CAGCGGAGTGAGAAGGAGCATGG - Intronic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906707303 1:47904095-47904117 CTGCAGAAGGAGCTGTAACAGGG + Intronic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906721761 1:48011288-48011310 GAGGAGAAGGAAGAGGAACAAGG - Intergenic
907290048 1:53407798-53407820 CAGCAGAAGGTGAAGGGAGCAGG - Intergenic
907477979 1:54719191-54719213 CAGCAGAGGGGTAAGGAATATGG + Intronic
907550208 1:55298704-55298726 CAACAGGAGGAGAAGCAAAAGGG + Intergenic
907868606 1:58422854-58422876 CAGCAGAAGCAGCAGAAGCAAGG + Intronic
907901536 1:58746012-58746034 CAGCAGAGGGAGAAAGAGCCAGG - Intergenic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908253977 1:62287310-62287332 CACCAGGAGGCGAAGGAACAAGG - Intronic
908395913 1:63725542-63725564 GAGCAGAAGGAAAAGGAGCAAGG + Intergenic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
908607778 1:65819083-65819105 TAGCAGAAGGAGAAGGGATGTGG + Intronic
908768015 1:67571548-67571570 CAGCTGAAGGAGAAGGGGCTGGG + Intergenic
908820672 1:68083074-68083096 CAGGAGAGGGAGAATGAAAAAGG + Intergenic
909396043 1:75171842-75171864 TGGCAGAGGGAGAAGGAGCATGG + Intergenic
909498886 1:76311104-76311126 CAGAAGAAGAAGAAATAACAAGG - Intronic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
910231518 1:84992341-84992363 CAGCTGAGGGAAAAGGAATATGG + Intronic
910333029 1:86097591-86097613 GAGGAGAAGGAGAAGGACGAGGG - Intronic
911411860 1:97519848-97519870 CAGCAGATGGAGAAGAAAGATGG - Intronic
911568535 1:99494305-99494327 CACCAGAGGGAGAAGGCACAAGG - Intergenic
911662947 1:100523945-100523967 CAGCAAAGGGAAAAGGCACATGG + Intergenic
911817317 1:102369263-102369285 CAGGAGACGGAGTGGGAACAGGG - Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
912411703 1:109484474-109484496 GGGCAAAAGGCGAAGGAACAAGG - Intronic
912463600 1:109853877-109853899 CACCAGAATTAGAAGGAAAAAGG - Intergenic
912869760 1:113293429-113293451 CAGCAGAAGAGGTAGGAACCAGG - Intergenic
913339482 1:117744403-117744425 CAGCAGAAGGAAAATAACCAAGG - Intergenic
913437976 1:118866740-118866762 GAGAAGAAGGGGAAGGAAGAAGG + Intergenic
913509688 1:119550450-119550472 CAGGAGAAAGAGAAGGCGCACGG + Intergenic
913561405 1:120024288-120024310 CACAAGAAGGTGAAGGAAAAGGG + Intronic
913636722 1:120769314-120769336 CACAAGAAGGTGAAGGAAAAGGG - Intergenic
914000609 1:143691636-143691658 CAGCGGGAGCAGAAGGGACACGG - Intergenic
914197926 1:145459820-145459842 CAGCGGGAGCAGAAGGGACACGG - Intergenic
914345417 1:146794581-146794603 GAGAAGAAGGAGAAGGACCTGGG + Intergenic
914388796 1:147199157-147199179 GAACAGAAGAAGAAGGAAAATGG + Intronic
914477028 1:148032952-148032974 CAGCGGGAGCAGAAGGGACACGG - Intergenic
914510574 1:148328977-148328999 CAGCGGGAGTAGAAGGGACACGG - Intergenic
914912678 1:151800180-151800202 AAGCAGAAAGAGAAGGAGCTGGG + Intergenic
915024316 1:152812851-152812873 GCCCAGAAGGAGAAGGAAGACGG - Exonic
915659419 1:157389831-157389853 CAGCAGAATTAGAAGGATCCAGG + Intergenic
916058254 1:161082593-161082615 TACCAGAAGGAGAGGGAAGAAGG + Intronic
916267331 1:162903891-162903913 CAGAAGAAAGTGAAGGAACTGGG + Intergenic
916282840 1:163071779-163071801 CAGCAGAGGGAAATGGAGCATGG - Intronic
916722277 1:167493368-167493390 GAACAGATGGAGAAGGAAAAAGG - Intronic
916814111 1:168334200-168334222 CATCAGAAAGAGAAGAAAGACGG + Intergenic
916977442 1:170096234-170096256 AACCACAAGGAGAAGTAACAAGG - Intergenic
917165684 1:172110124-172110146 CAGGGGCAAGAGAAGGAACAGGG - Intronic
917504224 1:175613604-175613626 CAGCACCAAGGGAAGGAACAGGG - Intronic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918320510 1:183359718-183359740 CAGCAGTGGGAGAGGGAAAATGG + Intronic
918702230 1:187619763-187619785 CAGAAGAAGGAGAAAGAACTTGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919321637 1:196048101-196048123 CAGTAGCAGGAGAAAGAAGAGGG + Intergenic
919594568 1:199546063-199546085 CAGCTGAAAAAGAAGGAAGAAGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
920176056 1:204102616-204102638 GAGCAGATGGAGGAGGAAGAGGG + Intronic
920262781 1:204700878-204700900 AAGAAGAAGAAGAAGGATCAGGG - Intergenic
920612870 1:207458718-207458740 CACTGGAAGGAGAAGGGACAGGG - Intronic
920800852 1:209186123-209186145 CAGCAGCAGGAGAAGGGAAGAGG - Intergenic
921253943 1:213322723-213322745 AAGAAGAAGGAGAAAGAAAATGG - Intergenic
921363435 1:214351617-214351639 CAGCAGCAGGCGAGGGAAGATGG + Exonic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921734512 1:218612031-218612053 AAGCAGATGAAGAAGGAAAAAGG - Intergenic
921852435 1:219945627-219945649 TTGCAGAAGGAGAAAGTACAAGG + Intronic
921945405 1:220882763-220882785 CAGCAGGAGGAGGAGGAAGGAGG - Intronic
922625636 1:227038740-227038762 CAGCAGCAGGAGATGCAACATGG + Intronic
923070778 1:230562593-230562615 CAGCAAAGGGAAAAGGCACAGGG - Intergenic
923099501 1:230801110-230801132 GAGCTGAAGGAGAAGTAGCATGG - Intronic
923378675 1:233392648-233392670 AAGGAGAAGGAAAAGGAAAAGGG - Intergenic
923394227 1:233544666-233544688 CGGCACAGGGAGAAGGAACCAGG - Intergenic
924043483 1:240006285-240006307 CAGAAGAAAGAGAAGAAGCATGG - Intergenic
924503402 1:244657777-244657799 CAGCAGTATGTGAAGGAAGATGG + Intronic
924643105 1:245852178-245852200 CAGGAGAAGGAGTAGGCCCAAGG + Intronic
1063264559 10:4433652-4433674 GAGGAGAAGGAGAAAGACCAGGG + Intergenic
1063623799 10:7671125-7671147 CAGAGGAAGGAGGGGGAACAAGG + Intergenic
1064048181 10:12037937-12037959 AAGAAAAAGGAGAAGGAAAAAGG - Intronic
1064516925 10:16160065-16160087 CAGGAGTAGAAGTAGGAACATGG - Intergenic
1065342139 10:24717560-24717582 GAGCAGAGGGAGGAGGAACAGGG + Intronic
1065375799 10:25040130-25040152 AAGCAGAAGCAGAAGCTACAAGG + Intronic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066670714 10:37835661-37835683 GAGGAGAACGAGAAGGAATAAGG + Intronic
1066952559 10:42135496-42135518 CACAAGAAAGATAAGGAACATGG - Intergenic
1067077858 10:43198280-43198302 CAGCAGACAGAGAAGGCACCTGG + Intronic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1067807916 10:49405918-49405940 AGGCAGGAGGAGAAGGAAAAGGG - Intergenic
1068028406 10:51677839-51677861 CATCAGAAGGAGAGGGAATTGGG + Intronic
1069119432 10:64550605-64550627 CAGAAGAAGGAGATAGAAAAGGG - Intergenic
1069577238 10:69539608-69539630 AAGGAAAAGGAAAAGGAACAGGG + Intergenic
1069617325 10:69814320-69814342 CAGGAGGAGGAGGAGGGACATGG + Intronic
1069851052 10:71405240-71405262 TCGGAGCAGGAGAAGGAACATGG - Intronic
1070342938 10:75514295-75514317 AAGAAGAAGAAGAAGGAAAAAGG - Intronic
1070822821 10:79372433-79372455 GAGCTGAAGGTGAAGGAAAAGGG + Intergenic
1070887922 10:79921142-79921164 CAGCAGGAGAAGAAGGAAAAGGG - Intergenic
1071110613 10:82150723-82150745 CAGCAGAAGCAGATGAAAGACGG - Intronic
1071167447 10:82823028-82823050 CAGAAGAAGGAAAAGTAAAAGGG - Intronic
1072041578 10:91611592-91611614 CAGGAGCAGGACCAGGAACAGGG - Intergenic
1072054962 10:91745729-91745751 AAAGAGAAGGAGAAGGAAGAAGG + Intergenic
1072304677 10:94095851-94095873 ACACAGAAGTAGAAGGAACATGG - Intronic
1072599450 10:96911545-96911567 TAACAGTAGGAGCAGGAACATGG + Intronic
1072683585 10:97523858-97523880 CCACAGAAGCAGCAGGAACAAGG - Intronic
1073254672 10:102143090-102143112 AATCAGAAGGTGAGGGAACATGG + Exonic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074732160 10:116390739-116390761 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1074944124 10:118264704-118264726 TAGCAGGAAGAGAAGGAGCAGGG + Intergenic
1075040055 10:119100953-119100975 CAGCAAAGGGAAAAGGCACATGG - Intergenic
1075200822 10:120402446-120402468 AAGCAGAAGGAGAAAGCTCAAGG + Intergenic
1075802342 10:125160925-125160947 CCGGGGAAGGAGAAGGAAAACGG + Intronic
1076105985 10:127824117-127824139 AAGCAGAGGGAGAAGCAGCATGG + Intergenic
1076271370 10:129155193-129155215 CAGGAGAAGCAGGTGGAACAAGG + Intergenic
1076297746 10:129400323-129400345 CAGCAGAAGGTGAATGACAATGG - Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076997628 11:306457-306479 CAGCAGAAGGAGGAGGACTTAGG + Intergenic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078188007 11:9068707-9068729 GTGCAGAAGGTGAAGCAACAAGG - Intronic
1078386583 11:10898386-10898408 CTCCAGAAGGAGCAGAAACAAGG - Intergenic
1078591450 11:12643809-12643831 CACTAGAAGGAGAAGAAAAAAGG + Intergenic
1078612937 11:12837701-12837723 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1079404108 11:20130030-20130052 TAGCAGAAGAAAAAGGAAAAAGG + Intergenic
1079445569 11:20553675-20553697 AAGGAGAAGGAGAAAGAAAAAGG - Intergenic
1079520446 11:21320142-21320164 CAGCAGGAGAAGAAGAAAAAGGG - Intronic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080862956 11:36166104-36166126 CAGCGGAAAGAGCAGGAACCAGG - Intronic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1081314895 11:41620220-41620242 TAGCAAAAGGAAAAGGAACTAGG + Intergenic
1081594501 11:44449977-44449999 CAGAAGTTGGAGAAGGAAAAAGG + Intergenic
1081596515 11:44463164-44463186 CAGCAGGAGGCCAAGGCACAGGG - Intergenic
1082243511 11:49893572-49893594 CAGGAGGAGGAGGAGGAGCACGG - Intergenic
1082248666 11:49955598-49955620 CCGCAGAATGAGTAGGCACAAGG + Intergenic
1083222745 11:61264250-61264272 AAGCAGAAGAAGAAGAAAAAGGG + Intronic
1083284249 11:61647767-61647789 CAGCAAAAGCATAAGGAACCAGG - Intergenic
1084185086 11:67467319-67467341 CAGCAGCAGGAGCAGGAAGGAGG + Exonic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1086048833 11:82565104-82565126 AAGAAGGAGGAGGAGGAACAAGG + Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086194309 11:84118692-84118714 CAGCAGCAGAAGCAGGAAGATGG + Intronic
1086327521 11:85719120-85719142 CAGCAGCAGGAGAAAGCACGGGG + Intronic
1086567136 11:88240120-88240142 CAGCAGAAGTTGGAGGACCATGG - Intergenic
1087159745 11:94937024-94937046 CAGTAGAATGAGAAGGAAAGAGG - Intergenic
1087307073 11:96500597-96500619 CAGCTGAATGAGAAGGAGGAGGG - Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087594743 11:100238490-100238512 CAGCAGCAGGAGGAGGAGAAGGG + Intronic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088270973 11:108034153-108034175 CAGCAAAGGGAAAAGGTACATGG + Intronic
1088630114 11:111766358-111766380 CAGCAGGAGGAGAAAGAACATGG - Exonic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089599704 11:119605730-119605752 AAGCAGAAGGCCAAGGAACAGGG - Intergenic
1089922662 11:122225026-122225048 CAGCAGCAGTAGAAGTAACAAGG + Intergenic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090697547 11:129263587-129263609 GAGGAGAAGGAGGAGGAAAATGG + Intronic
1091374293 12:15912-15934 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1091512560 12:1144060-1144082 AAGTAGAAGGAGAAGGAAATGGG - Intronic
1091579720 12:1776757-1776779 CTGCAGCATGAGAAGGAAGATGG + Intronic
1091621620 12:2093424-2093446 GAGCAGGAGGAGAAGTTACATGG + Intronic
1091656513 12:2350507-2350529 TAGCAGAAAGAGAAAGATCAAGG + Intronic
1091904897 12:4177436-4177458 CAGCACAAAGAAGAGGAACAGGG + Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092131141 12:6114157-6114179 CAGGAGAAGGAGAAACACCAAGG - Intronic
1092210811 12:6645338-6645360 CTGCAGGAAGAGAAGGAAAATGG + Intronic
1092753329 12:11739256-11739278 GAAAAGAAGGAAAAGGAACAGGG + Intronic
1092884781 12:12915605-12915627 GAGAAGGAGGAGAAGGAAGAAGG - Exonic
1092932198 12:13326602-13326624 CTGCAGAAGTTGAAGAAACAAGG + Intergenic
1093108265 12:15116236-15116258 CAGCAGAGGGAGAAGCCAAAGGG - Intronic
1093269132 12:17037099-17037121 CAAGAGAAGGAAAAGGAAAAAGG - Intergenic
1093692278 12:22121874-22121896 CAGCAGAGAAAGAAGGAAGATGG - Intronic
1093927424 12:24922905-24922927 CAGCAAAAGGAAAAGGCACATGG + Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094129903 12:27063588-27063610 CAGGAGGAGGAGGAGGAAGAAGG - Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1094491093 12:30961176-30961198 CAGCAGAAGAGGCAGGAAGAGGG - Intronic
1094619249 12:32064558-32064580 AAGAAGAAGGAGAGGGAAGAAGG + Intergenic
1094628768 12:32151699-32151721 CAGCAGAAGGAAGAGGAGCAGGG + Intronic
1095109301 12:38274470-38274492 CTGGAGGTGGAGAAGGAACAAGG + Intergenic
1095162068 12:38930416-38930438 TCCCAGAAGTAGAAGGAACATGG + Intergenic
1095800404 12:46266454-46266476 CAGCGGAAGGAACAGGAAGAAGG - Intronic
1096041982 12:48525660-48525682 CAGCCCAAGGAGGAGGAACTCGG - Exonic
1096192221 12:49627357-49627379 TTGCCGAAGGAGAAGGTACATGG + Intronic
1096204003 12:49706763-49706785 CAGCAGAAGGGGGAGGAAGAAGG + Intronic
1096320617 12:50609475-50609497 CAGTAGATGATGAAGGAACAGGG - Intronic
1096391452 12:51232314-51232336 AAGCAGAAGGGGAAGGAAGGAGG - Intergenic
1096532165 12:52249015-52249037 CAGGAGACTGAGAAGGCACATGG + Intronic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097285079 12:57870909-57870931 AAGCAGAGGGAGAAGGAAAGGGG - Intergenic
1097426633 12:59453787-59453809 CAGGAGAAAGAGCAGGAATAAGG + Intergenic
1097715844 12:62965165-62965187 GAGCAGAAAGAGAAGGGAAAGGG + Intergenic
1097971153 12:65634373-65634395 CAGCAAAAGGAAAAGGTGCATGG - Intergenic
1098032264 12:66267011-66267033 CAGCAGAAGGGGAAGAATCAAGG - Intergenic
1098141419 12:67453679-67453701 CGGCAGAATGAGGAGGGACAAGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100179396 12:92068686-92068708 CAAGAAAAGGAGAAGGGACAGGG + Intronic
1100264580 12:92963257-92963279 GAACAGAAGAAGAAGGTACAAGG - Intergenic
1100308014 12:93369046-93369068 TGGCAGAAGGAGAAGGAGAAGGG - Intergenic
1100389709 12:94137810-94137832 CATCAGAACCAGCAGGAACAGGG - Intergenic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100835432 12:98562675-98562697 CAGGAGAAAGGGAAGGAACTGGG + Intergenic
1101397696 12:104363028-104363050 CAGCAGAGGGAGATGGTAAAGGG + Intergenic
1101728931 12:107410683-107410705 AAGGAGAAAGAGAAGGGACAAGG + Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102408767 12:112698837-112698859 AAGGAGAAGGAGAAGGAAAAGGG - Intronic
1102689560 12:114749779-114749801 CAGCAGAAGAAAAAAGAAAAGGG + Intergenic
1102899318 12:116624064-116624086 AAGAAGAAGGTGAAGGAAGAAGG + Intergenic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103716771 12:122949666-122949688 CAGCAGGAGGAGAAGACAGAGGG + Intronic
1104526972 12:129532918-129532940 CCGCAGAGGGAAAAGGCACAGGG - Intronic
1105272552 13:18891941-18891963 CAGCAAAAGGAGAAGCAAAGGGG + Intergenic
1105531456 13:21224474-21224496 CAGCAGCAAGAGATGGAAGAAGG + Intergenic
1105652135 13:22390622-22390644 CAGCATAAAGAGAATGAAAAGGG - Intergenic
1105666014 13:22557364-22557386 CAGGAGGAGGAGAAGGAATATGG + Intergenic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106375498 13:29182910-29182932 CAGCTGAAGGGGAGGGAGCAGGG + Intronic
1106449474 13:29866983-29867005 CAGCAGAAGGGGAAAGAACATGG + Intergenic
1106587438 13:31069666-31069688 TAGCTGAAAGAGAAGGAACTGGG + Intergenic
1106753463 13:32797676-32797698 AAACAGAAGAAGAAGAAACATGG + Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1107217053 13:37934328-37934350 CAGCACAAGGAGAATGGAGAAGG + Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107300168 13:38957917-38957939 CCGCAGAAGTAGAATGCACAGGG + Intergenic
1107312043 13:39089761-39089783 CATCAAAAGGAGATGGAAAAGGG + Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1107859501 13:44647508-44647530 CAGCAAACTGAGAAGGAAGAGGG + Intergenic
1107975462 13:45683968-45683990 CAGCAGAGGGAGCAGCAGCAGGG - Intergenic
1108352991 13:49604256-49604278 TTGCAGAAGGGGAAAGAACAAGG + Intergenic
1109672346 13:65625868-65625890 AAGGAGAAGGAGAAGCAACAAGG + Intergenic
1109842645 13:67940101-67940123 CAGAAAAAGGAGAAAGACCATGG + Intergenic
1109955914 13:69565760-69565782 CAGCAAAAGGAAAAGTCACATGG - Intergenic
1110541954 13:76716236-76716258 AAGAAAAAGGATAAGGAACAGGG + Intergenic
1110598302 13:77342520-77342542 CAAGTGGAGGAGAAGGAACATGG - Intergenic
1110657109 13:78013116-78013138 CAGCAGAACAATAAGTAACAGGG - Intergenic
1110757106 13:79188353-79188375 CAGCAGAAAGAGATGCACCATGG + Intergenic
1111633249 13:90870481-90870503 CAGAAGAAGGGGAAGGACAAGGG - Intergenic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112069790 13:95836785-95836807 CAGCAAAGGGAAAAGGCACATGG - Intronic
1112489603 13:99849722-99849744 CACCAGGAGGAGATGGAAAAAGG + Intronic
1112935706 13:104795368-104795390 TAGCAGAAAGAGAATGAACGTGG + Intergenic
1113669453 13:112165765-112165787 GAGGAGGAGGAGAAGGAAGAGGG - Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1114540637 14:23455207-23455229 TACCAGAAGGAGAAGGAAATGGG + Intergenic
1115067021 14:29275740-29275762 CAGCAGAAGTGGAGGGAAAAAGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115531165 14:34328500-34328522 CAGCAGAAGGAGCAGCAGCTGGG + Intronic
1116475081 14:45330866-45330888 AAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1116742312 14:48772284-48772306 CAGCATGAAGAGAAGAAACAAGG + Intergenic
1116747869 14:48844958-48844980 CAGCAGAAGGTGGAAGAAGATGG + Intergenic
1116814482 14:49570704-49570726 CAGCAAAGGGAAAAGGCACATGG - Intergenic
1116903256 14:50381442-50381464 AAGCTGAAGGAGAGGTAACAGGG - Intronic
1117066915 14:52020100-52020122 CAACGGCAGGAGAAGGAACCAGG + Exonic
1117275019 14:54184694-54184716 CAGCAAAAGGAAAAGGAGAAAGG + Intergenic
1117498235 14:56326983-56327005 CAGCTGAAGAACAAGGAAGAAGG - Intergenic
1118266942 14:64303496-64303518 GAGCAGGAGGAGAATGCACATGG - Intronic
1118638459 14:67769742-67769764 CATCAGGAGGAGAAGAAAGAGGG + Intronic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1119084963 14:71731138-71731160 CAGCAGAAGGAAAAGAAACATGG - Intronic
1119196098 14:72717762-72717784 CAGCAGAAGGAGCAGGACCTAGG + Intronic
1119433085 14:74581065-74581087 GAGCAGAAGCAGGATGAACACGG + Intronic
1119601750 14:75981325-75981347 AAGAAGAAGCAGAAGGACCATGG + Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119922209 14:78456966-78456988 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121222967 14:92300209-92300231 CAGCAGAAGATGGAGGAACTGGG - Intergenic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121492840 14:94372246-94372268 GTACAGAAGGAGAAGGAAGAGGG - Intergenic
1121593267 14:95137174-95137196 AAGGGGAAGGAGAAGGAAAAGGG + Intronic
1121683195 14:95811415-95811437 AAGAAGAAGGACAAGGAGCAGGG - Intergenic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1121776211 14:96592764-96592786 CAGGAGCCGGAGCAGGAACAGGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122755825 14:103979265-103979287 CAACAGATGGAGAAAGAAAATGG - Intronic
1123448482 15:20345847-20345869 CAGGAGCAGGAGCAGGATCAGGG + Intergenic
1123965344 15:25450234-25450256 CAGCAAAGGGAAAAGGTACATGG - Intergenic
1124100695 15:26690083-26690105 CTGGAGAATGAGAAGGTACACGG + Intronic
1124176779 15:27433433-27433455 CAGCTGAAGGAGAATGTCCAGGG - Intronic
1124375842 15:29128204-29128226 CAGCAGAGGGAGAAAGGGCACGG - Intronic
1124899636 15:33810267-33810289 GCGCAGAAGGAGAAGGCTCAGGG + Intronic
1125003891 15:34796813-34796835 GAGGAGAGGGAGAAGGAAGAGGG + Intergenic
1125413346 15:39427801-39427823 CAGCACAAGGACAGGGAAAAAGG - Intergenic
1125442916 15:39722553-39722575 CAGGAGAAGGAAGAGGAACTAGG - Intronic
1125532752 15:40424258-40424280 CAGCAGAAGGGGAAGGCCCAGGG - Intronic
1125989693 15:44094272-44094294 AAGCAGAGGGAGAGGGAGCATGG + Intronic
1126079581 15:44946384-44946406 CAGCAGAAGGCTAAGGAGGAAGG + Intergenic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127395572 15:58541710-58541732 CAGGAGCTGGAGAAGGAAGAAGG + Intronic
1127566499 15:60194280-60194302 CAGGAAGAGGAGAGGGAACAGGG - Intergenic
1128033466 15:64502080-64502102 CAGCAGAATGAGAAAGAAAAGGG + Intronic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095675 15:64952843-64952865 AAGAAGAAGGAGAAGAGACAAGG - Intronic
1128396899 15:67235680-67235702 CAGCAGTAGGGAAAGGAAAAAGG + Intronic
1128458814 15:67850669-67850691 AAGCAGAGAGAGAAGGAACGAGG + Intergenic
1128557464 15:68641472-68641494 AAGCAGAAGGAGCAGGGAAAAGG + Intronic
1128648783 15:69395797-69395819 AAGCTCAAGGAGAAGGAACTAGG - Intronic
1128888232 15:71307840-71307862 TAGCAAAAGGAGAAGGCATATGG + Intronic
1129523272 15:76198923-76198945 GAGCAGAGGGAGTAGGGACAGGG + Intronic
1130437449 15:83915229-83915251 CAGGAGAAGAAGATGAAACAGGG - Intronic
1130878173 15:88032227-88032249 CAGCAGAAGGACAAGGAGAGGGG + Intronic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1131171476 15:90181903-90181925 GAGGAGAAGGAGCAGGAAAAGGG + Intronic
1131224403 15:90611985-90612007 GATAAGAAGGAGAAGGAAGATGG - Intronic
1131618818 15:94045371-94045393 CTGTAGCAGGAGATGGAACATGG - Intergenic
1131745434 15:95442415-95442437 CAGAAGAAGTAGAAGTGACACGG + Intergenic
1131909116 15:97177278-97177300 CAGCCACAGGAGAGGGAACAAGG - Intergenic
1132004092 15:98210628-98210650 AAGGAGAAAAAGAAGGAACAAGG + Intergenic
1132038023 15:98502605-98502627 CAGCAGAAAGAGAAAGGAAAGGG + Intronic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1132892371 16:2210594-2210616 CAGCAGCAGGAGCAGGCTCACGG + Exonic
1132939112 16:2498339-2498361 CAGCAGAAGGGGCTGGCACAGGG - Exonic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1133255636 16:4514187-4514209 GGGCTGAAGGAGAAGGAACCTGG - Intronic
1133344034 16:5058442-5058464 CAGGGGAAGGGGAAGGAAAAAGG - Intronic
1133407517 16:5537077-5537099 TAGCAGAAGTACAAGAAACATGG - Intergenic
1133447440 16:5874197-5874219 AAACAGAAGGAGAAGACACATGG + Intergenic
1133982022 16:10640060-10640082 GAGAAGAAGGAGAAAGAAAAAGG - Intronic
1134330811 16:13249695-13249717 CAAGTGAAGGAGAAGGAAGAGGG - Intergenic
1134404147 16:13940417-13940439 CAGCAAAGGGAAAAGGCACATGG + Intronic
1134410348 16:13998724-13998746 AAGAAGGAGGAGGAGGAACAAGG + Intergenic
1134898608 16:17913464-17913486 AAGATGATGGAGAAGGAACATGG + Intergenic
1135053034 16:19207710-19207732 GAGCAGAAAGATAGGGAACAAGG + Intronic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1136081336 16:27854307-27854329 GAGGAAAAGGAGAAGGAAAAGGG + Intronic
1137406888 16:48196279-48196301 CAGGAGGAGGAGATGGAAGAAGG - Exonic
1137483977 16:48876439-48876461 CAGGAGAAAGAGATGAAACAAGG - Intergenic
1137530597 16:49276549-49276571 CAGCAGGTGGAGAAAGAAGAGGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137712240 16:50574488-50574510 CAGCAGCAGGAGGAGCAAAATGG - Intronic
1138044282 16:53704456-53704478 CAGAAGAAGGACAAGGAAATGGG - Intronic
1138124841 16:54430244-54430266 TGGCAGAAGGAGAAAGGACAAGG + Intergenic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138403846 16:56772190-56772212 CAGAAAAAGGATAAAGAACATGG + Intronic
1138537660 16:57668373-57668395 GAGCAGGAGGAGCAGGAGCAGGG - Exonic
1138677368 16:58661443-58661465 TTGCAGAACTAGAAGGAACAGGG - Intergenic
1138938410 16:61759432-61759454 CAGTAGTAGGAGGAGGAAGAGGG + Intronic
1139208542 16:65053186-65053208 GAGCAGATGGAGAAGGTAAATGG + Intronic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139474616 16:67196840-67196862 CAGCAGAAGGAGGAGGGATAAGG - Intronic
1139575851 16:67841829-67841851 CAGCAGAGGGAGACGAAACCTGG - Intronic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140970494 16:80007796-80007818 CAGCAGAAGGCGAATGGACACGG - Intergenic
1141211655 16:81986447-81986469 GAGGAGAAGGAGAGGGAATAGGG + Intergenic
1141342839 16:83218947-83218969 CAGAAGATGGAGGAAGAACAAGG - Intronic
1141368890 16:83469121-83469143 CAGCAGAAGCAGAAAGTTCAAGG + Intronic
1141740940 16:85892425-85892447 CAGCACAAGGAAAAGATACACGG - Intergenic
1141775828 16:86121970-86121992 AAGGAGAAGGAGGAGGGACAAGG - Intergenic
1141931631 16:87208500-87208522 CAGCAAAAAGAGAAGGAGAAAGG + Intronic
1142614927 17:1128606-1128628 CAGCAACAGAAGGAGGAACAAGG - Intronic
1142792039 17:2274484-2274506 GAGCAAAAGGAGAGAGAACAAGG + Intronic
1142858339 17:2745961-2745983 AAGGAGAAGGAGAAGGACAAGGG - Intergenic
1143724339 17:8835181-8835203 CAGGAGAAGGAGGAAGAGCAGGG + Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1145122174 17:20269789-20269811 CAGCAAAGGGAAAAGGCACAGGG - Intronic
1145839613 17:27983568-27983590 CAGGTAAAGGAGAAGGCACAGGG + Intergenic
1145891171 17:28416841-28416863 CAGCCCAAGGAGAAGGATAAAGG + Intergenic
1145900698 17:28488860-28488882 CAGAAGAAGGAGCAGGACCTGGG - Intronic
1145984364 17:29035199-29035221 GAGAAGAAGGAGAAGAAAGAAGG - Intronic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146319795 17:31838070-31838092 CAGCAGGAGGCGGAGGCACAGGG + Intergenic
1146453992 17:32995422-32995444 TCACAGAAGGAGAAGAAACAGGG - Exonic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1147053979 17:37819716-37819738 CAACAGAAGAAGGAGGAAGAGGG - Intergenic
1147390428 17:40106017-40106039 AAGTAGAAGGGGCAGGAACAGGG + Intergenic
1147490630 17:40863048-40863070 CAGCAGAAATAGAAGGAATGGGG - Intronic
1147773906 17:42887007-42887029 CAGCAGAGGCAGCAGGAAGAGGG + Intergenic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1148956680 17:51360001-51360023 CAGCAGAAGGGTTAGGAAGAAGG - Intergenic
1149004205 17:51788105-51788127 CAGCAAAAGGAGTACTAACAGGG - Intronic
1149019684 17:51948599-51948621 CAGAATAAGGAGAAGGGACTGGG - Intronic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150574349 17:66416744-66416766 CAGCAGGAGGAGGAAGCACAAGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151111403 17:71682343-71682365 CAGCAGTAGGATAGGGAAGAAGG - Intergenic
1151483654 17:74385147-74385169 CAGGGGAAGGAAAAGGAAAAGGG + Intergenic
1151645473 17:75427920-75427942 CAGGAGAAGGTGAAGTAACGTGG + Intergenic
1151699910 17:75737571-75737593 CGGCAGGAGGAGGAGGAGCAGGG - Exonic
1152103453 17:78315842-78315864 CAGGAGGAGGAGGAGGAGCAGGG - Intergenic
1152239171 17:79152634-79152656 CCCCAGAAGGAGACGGAAAAGGG + Intronic
1152676679 17:81644969-81644991 CTGCAGAGGGAAGAGGAACAGGG - Intronic
1152872751 17:82766780-82766802 CAGCAAAGGGAAAAGGCACATGG + Intronic
1153030541 18:709413-709435 CAGCTGAAGGAGAAATAACAAGG + Intronic
1153322250 18:3784876-3784898 CAGCAGGAGGACAAGGGACAAGG - Intronic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1153748621 18:8206969-8206991 CACCAGAAGCTGAAAGAACAAGG + Intronic
1153749043 18:8210443-8210465 CACCAGAAGCTGAAAGAACAAGG + Intronic
1153765577 18:8371731-8371753 CAGCAGAAAGAGGGGGAATAAGG - Intronic
1154230648 18:12553189-12553211 AAGCAGAGGGAGAAGTAAAAGGG + Intronic
1154464335 18:14629524-14629546 CGGCAAAAGGAGAAGCAAAAGGG + Intergenic
1155297921 18:24402240-24402262 CAGCTGAAGGAGCAAGAGCAGGG + Intergenic
1155324622 18:24653270-24653292 CAGCAAAGGGAAAAGGCACATGG - Intergenic
1155749360 18:29400634-29400656 CAGCACTAGTAGAAGCAACAAGG - Intergenic
1156295607 18:35787175-35787197 CATGAGGAGGAGAAGGCACATGG - Intergenic
1156729239 18:40170372-40170394 CAGAAGAAGGAGAAGAAAAAAGG + Intergenic
1157141429 18:45111086-45111108 CTGCAAAAGGGCAAGGAACATGG - Intergenic
1157237605 18:45979188-45979210 AAGAAGAAGGAGAAGGGAGAGGG - Intergenic
1157244426 18:46040894-46040916 CAGGAGAGGGAGAAGGAGCTGGG + Intronic
1157407165 18:47431584-47431606 CAGCAAAAGGAGAAAGACAAAGG - Intergenic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157612969 18:48970056-48970078 CAGCTGAGGGAGAAGGAATGAGG - Intergenic
1157783947 18:50465410-50465432 CACCAGATGGAATAGGAACATGG + Intergenic
1157894004 18:51447179-51447201 GAGCAAAAGGAGAAGGAAAGAGG + Intergenic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1159093924 18:63880804-63880826 CAACAAAAGGAGAAGTCACAAGG - Intronic
1159175326 18:64826446-64826468 CACCAGTAGGAGAGTGAACAAGG + Intergenic
1159210854 18:65319259-65319281 CAGCAGAAGGGGAAGACCCAGGG + Intergenic
1159310289 18:66698551-66698573 AAGCAGAAGGAGGAGGAGAAAGG + Intergenic
1159995801 18:74962677-74962699 CAGCACCAGGAGAGGGAAGAGGG - Intronic
1160013827 18:75125915-75125937 CTGCAGAGGGAGGAGGAACAGGG - Intergenic
1160217806 18:76948569-76948591 CAGCGGAAGGAAAAGGCACGTGG + Intronic
1160503422 18:79413715-79413737 CAGGAGACGAAGAAGGAACCAGG - Intronic
1160657614 19:281601-281623 GAGCAGGAGGGGGAGGAACAGGG + Intronic
1160839722 19:1140671-1140693 CGTCAGCAGGAGAAGGCACACGG + Intronic
1161437271 19:4271126-4271148 CAGCAGAAGGAGTTGGCAGAGGG + Intergenic
1161882808 19:6968654-6968676 CAGCAGAAAGAATAGCAACAGGG - Intergenic
1162205704 19:9054705-9054727 CAGAAGAGAGAGAAGGAACTGGG - Intergenic
1163211697 19:15845594-15845616 AAGAAGAGGGAGAAGGAAGAAGG + Intergenic
1163411776 19:17159359-17159381 AAGGAGAGGGAGAAGGAAAAGGG - Intronic
1163516273 19:17765786-17765808 CAGCAGGAGGAGAAGGTGGAGGG + Intronic
1163648312 19:18502723-18502745 CAGGAGGAGGAGTGGGAACACGG + Intronic
1163965335 19:20741455-20741477 CTGAAGAAGGAGAAATAACATGG - Intronic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1164292696 19:23881842-23881864 GAGGAGAAGGAGGAGGAAGAGGG + Intergenic
1164814492 19:31184888-31184910 GAGCAGAATGAGAAGGGAGAAGG + Intergenic
1165671057 19:37679501-37679523 CACCAGAAAGAAAAGGTACATGG - Intronic
1165714433 19:38035314-38035336 CAGCAAGAGGAGCAGGAACATGG - Intronic
1165925645 19:39324531-39324553 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1166034963 19:40161426-40161448 AAGCAGAAGGGGAAGGGAAAGGG + Intergenic
1166293350 19:41877345-41877367 CAGCAGGAAGAGGAGGAAGATGG - Exonic
1166300560 19:41909989-41910011 CTGCAGAAGGAGGAGTACCAGGG - Intronic
1166497126 19:43311697-43311719 CAACAGTAGGAGAAGGAAGGTGG + Intergenic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166760685 19:45222596-45222618 GAGCAGAAGCAAAAGAAACAGGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167172696 19:47843809-47843831 AAGAAGGAGGAGGAGGAACAGGG + Intergenic
1167534357 19:50040184-50040206 CAGCAAAGGGAGGAGGTACATGG + Intronic
1167608138 19:50492703-50492725 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167722309 19:51187024-51187046 CATCAGAAGGAGGAGGATTACGG - Intergenic
1168246707 19:55116243-55116265 CCCCAGAAGGAGAAGGAAAAGGG + Intronic
1168359957 19:55731216-55731238 CAGCAGAGGGAAAAGGCATATGG + Intronic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925571867 2:5321122-5321144 CAGGAGATGAAGGAGGAACAAGG - Intergenic
925704699 2:6673367-6673389 AAGCAGAAGGAAAAGGAGAAGGG + Intergenic
925843176 2:8011396-8011418 TATGAGAAGGGGAAGGAACAGGG - Intergenic
925971142 2:9107490-9107512 CAGCAGAAGTAGCACAAACAGGG + Intergenic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926231797 2:11010046-11010068 CAGCAGAAGGAGGAGGCCAAGGG + Intergenic
926328167 2:11803230-11803252 CAGCAAAAGGAGAAGACAAAAGG - Intronic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
926404560 2:12537980-12538002 CAGCAGGATGAGAAGCATCAAGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926783830 2:16500419-16500441 CAGTAGAAGGAGGAGAAACAGGG - Intergenic
927072752 2:19547858-19547880 CAGAAGAGTGGGAAGGAACAAGG + Intergenic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
927244370 2:20945209-20945231 CAGCAGAAGAAGAAGAGATATGG - Intergenic
927324156 2:21783807-21783829 TAGCAGGAGGAAAGGGAACAAGG + Intergenic
927488479 2:23505157-23505179 CAGCAGAAAGTGAGGGACCATGG - Intronic
927943787 2:27122576-27122598 CAGGGGAAGAAGGAGGAACATGG - Intergenic
928019304 2:27689446-27689468 CAGCAAAGGGAGAAGGAACATGG + Intronic
928229622 2:29486129-29486151 CAGCACAAGGAGAGATAACATGG - Intronic
928312331 2:30221218-30221240 GAGCAGAAGGGAAAGGAACTTGG - Intergenic
929362119 2:41104280-41104302 CAGGAGAAGGAAAAGAAAGAAGG - Intergenic
929691279 2:44076071-44076093 TGACAGAAGGAGAAGGACCAGGG + Intergenic
929864778 2:45708802-45708824 CAACAGAGGGAGAAGGCACCTGG - Intronic
929898422 2:45981460-45981482 AAGCAGAAGGAGAGAGAAGATGG - Intronic
929934136 2:46282065-46282087 ATGGGGAAGGAGAAGGAACAAGG + Intergenic
930570156 2:53076430-53076452 CATCAAAAGGAAAAGGAACATGG + Intergenic
930833546 2:55771086-55771108 CAGCAGAAGGAGGAAGAGCATGG + Intergenic
931201395 2:60100668-60100690 CAGAAGGAGGAGAGGGCACATGG + Intergenic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932283890 2:70516899-70516921 CAGGATAGGGAGCAGGAACAGGG - Intronic
932733946 2:74241135-74241157 AGGCAGAAAGAGAAGGAAGAAGG + Intronic
932871688 2:75406634-75406656 GTGCAGAAGGAGACGGAGCATGG - Intergenic
934833746 2:97562518-97562540 AAGCAGAAGCAGAAGTTACAAGG - Intronic
934960142 2:98665833-98665855 CTGCAGAAGAGGAAGCAACAAGG + Intronic
935078623 2:99770516-99770538 AAGCAGAAGGAAAAGTAAAAGGG - Intronic
935383370 2:102476665-102476687 AAGAAGGAGGAGAAGGAAAACGG + Intronic
935542688 2:104368132-104368154 CAGGAGAAGGACAAATAACAGGG + Intergenic
935794743 2:106630262-106630284 CAACTGAAAGAGAAGGAACCTGG - Intergenic
936272489 2:111059927-111059949 GAGAAGAAGGAGGAGGAAGAGGG + Intronic
936274579 2:111083390-111083412 CAGCAAAGGGAAAAGGTACAGGG + Intronic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936568520 2:113597617-113597639 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
936658476 2:114515723-114515745 CAGAAAAAGAAGAAGGAAAAGGG - Intronic
936675389 2:114708429-114708451 CAGCAGAAGGGGGAAGAACTGGG + Intronic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937490877 2:122365941-122365963 AGGCAGAAGGAGAAAGAAGAAGG + Intergenic
938475534 2:131608234-131608256 CAGCAGCAAGAGCAGGAGCAAGG - Intergenic
938619266 2:133032082-133032104 AAGCAGAAGGAAAAGTAAAAAGG + Intronic
938779403 2:134571653-134571675 CGGCAGAAGGAAAAGGTGCATGG + Intronic
938785856 2:134628742-134628764 CAGCAAAGGGAGACGGCACATGG - Intronic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
939209864 2:139160458-139160480 CAGCAGACATGGAAGGAACAGGG + Intergenic
939643844 2:144672191-144672213 GAGCAGATGGAGGAGCAACAAGG - Intergenic
939673795 2:145046642-145046664 CAGCAGAAGGCTGAGGAGCAAGG + Intergenic
939719753 2:145634090-145634112 GACCATAAAGAGAAGGAACATGG + Intergenic
940328471 2:152450700-152450722 CAGCAGGAGGAGATGCCACATGG - Intronic
940579801 2:155564104-155564126 CAGAAGAAAGAGAGGGAAAAAGG + Intergenic
940584732 2:155632636-155632658 TAGCACAAGGAGAAAGAACCTGG + Intergenic
941452660 2:165678320-165678342 CAGCAGAAAGAAAAGGAACTTGG + Intronic
941460890 2:165770270-165770292 GAGCAAAAGGAAAAGGAACGTGG - Exonic
941461089 2:165772784-165772806 CAGCATAAGTGGAAGGCACAGGG + Intronic
941609781 2:167646417-167646439 TAGGAGAAGGAAGAGGAACAGGG - Intergenic
941660621 2:168192225-168192247 CAGCAGGCAAAGAAGGAACATGG + Intronic
941727227 2:168874666-168874688 CAGCAAAGGGAAAAGGTACATGG + Intronic
942103332 2:172607762-172607784 CAGGGGAAGGAAAAGGAGCAGGG + Intronic
942328220 2:174793711-174793733 CAGAAGAAGGAGGCAGAACATGG - Intergenic
942345754 2:175001102-175001124 CACCAGTACAAGAAGGAACATGG + Intronic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943787918 2:191899490-191899512 CAAAAGAAGCAGAAGGAAAACGG + Intergenic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944490418 2:200253105-200253127 CATCAAAAGGAGAAGCAACAAGG + Intergenic
944631746 2:201633787-201633809 CAGCAAAAGGAAAAAGTACATGG + Intronic
944743660 2:202635320-202635342 CAGCAGCAGCAGCAGCAACATGG + Exonic
944796838 2:203195632-203195654 CAGCAAAGGGAAAAGGCACATGG + Intronic
944881264 2:204015117-204015139 CAGCAGGAAGAAAAGGCACATGG + Intergenic
945198278 2:207257417-207257439 GAGCAGAAGGAAAAGGAAATAGG - Intergenic
945985921 2:216353536-216353558 AAGAAGAAGAAGAAGAAACAAGG - Intronic
945986484 2:216358520-216358542 CAGCAGAAGTAGAAGCAGCGTGG + Intronic
946182386 2:217956405-217956427 CAGCAGAAGGGGGAGTAACAAGG + Intronic
946592167 2:221262618-221262640 AAGCTGGAGGAGGAGGAACAAGG - Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
947228978 2:227866494-227866516 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
947252101 2:228118887-228118909 CAACAGAATGAAAAGGAAAATGG - Intronic
948326088 2:237122471-237122493 CAGCAGAGGGAGAAGAGACCTGG + Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948998316 2:241596049-241596071 CAGCGGAAGGACATGGAGCACGG - Intronic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1170010835 20:11721896-11721918 AAGCAAAAGCAGATGGAACAAGG + Intergenic
1170160606 20:13306540-13306562 CAGCAAATGGAGAAGGAGAAAGG + Intergenic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170857891 20:20074279-20074301 CTGCAGAAGAAGAGAGAACACGG - Intronic
1171489171 20:25504488-25504510 ACCCAGGAGGAGAAGGAACATGG + Intronic
1171506738 20:25642450-25642472 CAGCAGAAGGTGCAGGAGAAAGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172283367 20:33723624-33723646 CAGCTGAAGGAGAAGGAAAGAGG + Intergenic
1172468061 20:35171869-35171891 CAGCCCAAGGAGAAGGGAAAAGG + Intergenic
1172560565 20:35884348-35884370 CAGCAGGAGGAGGAGGAGCTGGG + Intronic
1172602097 20:36190870-36190892 CTGCAGAATGAGCAGGAAAATGG + Intronic
1172964449 20:38824467-38824489 CAGAAGGAGAAGAAGGAACTGGG - Intronic
1173056688 20:39621478-39621500 AAGAAGAAGGAGGAGGAAGAGGG - Intergenic
1173388434 20:42609697-42609719 TAGGAGAAGGGCAAGGAACAGGG + Intronic
1173501857 20:43559675-43559697 CAGCAGCAGGAGAGGGTGCATGG + Intronic
1173620116 20:44430115-44430137 CAGCAGCAGAAGGAGGAGCAAGG - Exonic
1173727071 20:45305538-45305560 CTGAAGAAGGAGCAGCAACACGG + Exonic
1173909650 20:46656874-46656896 CAGCAAATGGAGAAGGCAGAAGG - Intronic
1174011651 20:47454600-47454622 GAGGAGGAGGAGAAGGAAAAAGG - Intergenic
1174033179 20:47647387-47647409 CAACAGAAGGAGAAGCCAGAGGG - Intronic
1174564093 20:51452311-51452333 CAGCAGGAGGAGGAGAACCAGGG - Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174960501 20:55151686-55151708 CAGCAGTAGGAGGAGGAAGAAGG - Intergenic
1175100631 20:56576269-56576291 TAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1175531201 20:59675026-59675048 GAGGAGAAGGGGGAGGAACAGGG - Intronic
1175661420 20:60816262-60816284 AAGAAGAAGGAGGAGGAGCAAGG - Intergenic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1176810203 21:13528865-13528887 CGGCAAAAGGAGAAGCAAAAGGG - Intergenic
1177027777 21:15941912-15941934 GAGCTGAAGAAGAAGGATCATGG - Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177299257 21:19219574-19219596 AAGCAGAAGGGGAAGGGAGAAGG + Intergenic
1177490163 21:21813550-21813572 ATGCAGAAGGACAAGGGACAAGG + Intergenic
1177516982 21:22165886-22165908 CAGTAGAAAAAGAAGAAACAAGG + Intergenic
1177613206 21:23481514-23481536 CAGCAGAAGAAAAAGGAATAAGG + Intergenic
1177844421 21:26272030-26272052 CAGCAAGGGGAGAAGGCACAGGG - Intergenic
1178016125 21:28347596-28347618 AAGGAGAAGGAGAAGAAAAAGGG - Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178745265 21:35243448-35243470 GAGGAGATGGAGAAGGAAGAGGG - Intronic
1178948159 21:36965641-36965663 CAGAAGATGGAGAGGGAAAAGGG + Intronic
1178970133 21:37167090-37167112 CCTCAGAAAGAGAAGGAAAAAGG + Intronic
1179173361 21:38990200-38990222 AAGTAGAAGGAGAAGGGAAAAGG + Intergenic
1179192249 21:39133402-39133424 CAGCAGAAAGAGAATCAACTGGG - Intergenic
1179265409 21:39798391-39798413 CGGCAGAGGGAGAAAGAGCATGG - Intronic
1179466651 21:41580278-41580300 CAGCAGCTGGAGGAGGGACAGGG + Intergenic
1179945017 21:44667383-44667405 TAGCAGATGGAGGAAGAACATGG + Intronic
1180102259 21:45594168-45594190 CACGAGGAGAAGAAGGAACAGGG - Intergenic
1180202048 21:46229757-46229779 CAGCAGAGGGAAGAGGAAGATGG + Intergenic
1180228906 21:46414596-46414618 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180228924 21:46414665-46414687 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1181572126 22:23773291-23773313 CAGCAGAGGGAGTGGTAACAGGG + Intronic
1181937307 22:26448175-26448197 CAGCACAGGGAGAAGGACCTGGG - Intronic
1182428689 22:30288109-30288131 CAGCAGCAGGAGGAGGAGCTAGG + Intronic
1182431165 22:30299647-30299669 CAGCAGCAAGAGCAGAAACAGGG + Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182902087 22:33906994-33907016 AAGCAGAAGAAAAAGGAAAATGG + Intronic
1183042412 22:35192209-35192231 CAGCAAAAGGAAAAGGCATATGG - Intergenic
1183044739 22:35210816-35210838 CTACAGAAGCAGAAGGAAAATGG + Intergenic
1183146328 22:35995879-35995901 CAGGAGGAGGAGGAGGAAAAGGG - Intronic
1183270122 22:36856720-36856742 CAGCAGAGGGAGACAGAAAAGGG + Intergenic
1183511960 22:38241161-38241183 CAGCACAGGGAGAAGGCACCAGG + Intronic
1184208854 22:43023504-43023526 CAGCAGAAGAAGGGGGGACAGGG - Intergenic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184696543 22:46142654-46142676 CGGCAGAAGGAGCAGGAGCGGGG - Intergenic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
1184857372 22:47153751-47153773 GAGAAGAAGGAGAAGAAACTGGG + Intronic
1184929022 22:47666752-47666774 GAGCAGAAGAAGAAGAAAAAAGG - Intergenic
1185215203 22:49595142-49595164 CAGCAGCATGAGAAGACACACGG + Intronic
949328865 3:2898926-2898948 CAGCAGGAAGATAAAGAACAAGG + Intronic
949347769 3:3092782-3092804 CAGTAGAAGGAAAAAGAAGAAGG - Intronic
949881236 3:8662579-8662601 ATGAAAAAGGAGAAGGAACAAGG + Intronic
950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG + Intergenic
950913747 3:16621553-16621575 CAGGAGAAAGGGAAGGAATATGG + Intronic
951052334 3:18108256-18108278 CAGGTGAAGGGGAAGGATCATGG - Intronic
951162546 3:19442317-19442339 CATCAGGAGTAGAAGAAACATGG - Intronic
951305875 3:21061395-21061417 TAGGAGAAGGAAAAAGAACATGG - Intergenic
952188964 3:31001800-31001822 CAGCAGAAGCAGGAACAACAGGG + Intergenic
952751284 3:36827015-36827037 CAGCAAAAGCAGCAGCAACATGG + Exonic
952769422 3:36984389-36984411 GAGGAGAGTGAGAAGGAACAGGG + Intergenic
953807829 3:46086610-46086632 CAGGAGGAGAAGAAGGCACAGGG - Intergenic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954551285 3:51483752-51483774 GAGCAGTGGGAAAAGGAACATGG - Exonic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
955636221 3:61032543-61032565 CAGCAAAACCAGAAGGAGCAGGG + Intronic
955941492 3:64150539-64150561 GAGAAGAAGGAGGAGGAAGAAGG - Intronic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
956368723 3:68534846-68534868 CTGAAGGAGGAGGAGGAACAGGG + Intronic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
956503820 3:69915832-69915854 AAGGATAAGGAAAAGGAACAGGG - Intronic
956846548 3:73188870-73188892 CAGGAGAAGGAGGAGGAAAGAGG - Intergenic
956911570 3:73822872-73822894 TAGCAGAAGGAGTAGCAAAAGGG - Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958833548 3:99117670-99117692 AAGAAGGAGGAGAAGGAAAAAGG + Intergenic
959710323 3:109379183-109379205 GACCAGAAGGAGGAGGAAGAGGG + Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960088538 3:113615872-113615894 CAGCAGAAAGGCAAGGAAGATGG - Intronic
960471837 3:118075612-118075634 AAGCAGAGGGAAAAGTAACAGGG - Intergenic
960702381 3:120451062-120451084 CAGCAGAAGGGGGAGGAGAATGG - Exonic
960738500 3:120806398-120806420 CAGCAGAAACACAAGGGACATGG + Intergenic
960937279 3:122911847-122911869 CTTCAGAAGGAGAAGGAAGTTGG + Intronic
961072614 3:123948893-123948915 CACCAGAATGAGAGGGAGCATGG + Exonic
961823467 3:129586884-129586906 CAGCAGAGGCAGAAGCATCAAGG - Intronic
961935205 3:130575683-130575705 CTCCAGAAGGAGAAGGTACTAGG + Intronic
962265838 3:133943779-133943801 CAGAGGAAGGACAAGGAACTTGG - Intronic
962371424 3:134823860-134823882 CAGCAGAATGAGAAGAAAGCAGG + Intronic
962672515 3:137723493-137723515 CAGCAGAGGGACAAGGCAAATGG + Intergenic
963062998 3:141240439-141240461 CAGCTGAAGAGGAAGGAACATGG + Intronic
963422531 3:145078324-145078346 CACCAGAAGCTGAAGGAACAAGG - Intergenic
963437894 3:145294939-145294961 CAGCAGAGGCAGAAGGCACTAGG + Intergenic
964429044 3:156584736-156584758 CAGCAAAAGCATAAAGAACAAGG + Intergenic
964493138 3:157258500-157258522 CAAAAGAGGGAGAAGGAACATGG - Intergenic
964628536 3:158783327-158783349 CAGCAAAGGGAAAAGGCACATGG + Intronic
964758157 3:160107470-160107492 CAGCAAAGGGAAAAGGCACATGG - Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965026164 3:163304110-163304132 AAGCAGAAGGAAAAGTAAAAGGG + Intergenic
965965291 3:174481691-174481713 CAGCAAAGGGAAAAGGTACATGG + Intronic
966099187 3:176245396-176245418 CAGAAGGAGGAGAAGGGAGATGG + Intergenic
966246594 3:177815227-177815249 CAGAAGAAGAAGATGGAACCAGG - Intergenic
966319891 3:178690516-178690538 GAGGAGAATGAGAAGGAAGAAGG + Intronic
966521900 3:180882344-180882366 AAGAAGAAGGAGACGGAAGAAGG - Intronic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967108705 3:186273954-186273976 GAGCAGGAGGAGAAGGCAGAGGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
968276667 3:197445632-197445654 AAGGAGCAGAAGAAGGAACAGGG - Intergenic
968342665 3:197970400-197970422 CAGCAAAGGGAAAAGGATCATGG + Intronic
968515126 4:1012499-1012521 CGGCAGCAGGAGCAGCAACAGGG - Exonic
968752990 4:2399892-2399914 CAGCACAAGGTGGAGGAACAGGG + Intronic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
969154815 4:5201269-5201291 CAGAAACAGGAGAAGGGACAAGG - Intronic
969563108 4:7961905-7961927 CAGCATGAGGAGAGGGATCATGG - Intergenic
969695187 4:8730251-8730273 CAGCAGCATGAGAAGGAGCAGGG + Intergenic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
969929201 4:10613695-10613717 CCCCAGCAGGAGATGGAACAGGG + Intronic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
969990172 4:11253919-11253941 CCAAAGCAGGAGAAGGAACAGGG - Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970276016 4:14402155-14402177 CTGCTGAAGCAGAAGGAAAAGGG + Intergenic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
970892694 4:21066288-21066310 CAGAAGAAGGCCAAGCAACATGG + Intronic
971201581 4:24514029-24514051 CAGCAGGGGGAGAGGGAGCACGG + Intergenic
971231757 4:24805870-24805892 CAGCAGGAAGAGCAGGAAGATGG + Intergenic
971793432 4:31198094-31198116 GAGGAGAAGGAGAAGGTACCAGG - Intergenic
972033762 4:34494617-34494639 CAGCAGAAGAAAGAAGAACAAGG - Intergenic
972373930 4:38452705-38452727 CAGCAGAAGAAGAAAGAATATGG + Intergenic
973936296 4:55850210-55850232 CAGCAGATGGAGAAGCCAGAAGG + Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974273342 4:59681068-59681090 GAGCTGAAGGAGAAGGAACTGGG + Intergenic
974533801 4:63148413-63148435 ACGGAGAAGGAGAAGGAAAAAGG - Intergenic
974753775 4:66176790-66176812 AAGGAGAAGGAGAAGGGAAAGGG + Intergenic
975501314 4:75088343-75088365 TATAAGAAGGAGAAGCAACAGGG - Intergenic
975627383 4:76363375-76363397 CAGCAAAAGGAAAAGGCACACGG - Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976722486 4:88182743-88182765 CAGCAAAAGGAGTACTAACAGGG + Intronic
976777202 4:88719682-88719704 GAGAAGAAGGAGAAGAAAAAAGG - Intergenic
976895430 4:90104304-90104326 CAGTCAAACGAGAAGGAACATGG + Intergenic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
977005868 4:91569233-91569255 CAGAGCAATGAGAAGGAACATGG - Intronic
977049640 4:92113133-92113155 GAGCAGAAGCAGAGGGTACACGG - Intergenic
977277084 4:94991164-94991186 CAGTAGAAGGAGAATGAAAAAGG - Intronic
977422423 4:96818944-96818966 GAGCAGGAGGAGAGAGAACAGGG - Intergenic
977468114 4:97407379-97407401 AAGCAGTAGGAGAAAGAAGAAGG - Intronic
977980721 4:103318264-103318286 AAGGAGAAGGAGGAGGAGCAGGG - Intergenic
978562979 4:110053220-110053242 CAGAAGAAGAAGAAGAACCAGGG - Intronic
978678834 4:111353259-111353281 CACCATCAGGAGAAGGAAAATGG + Intergenic
978737338 4:112098867-112098889 GAGCAAAAAGAGAAAGAACAAGG + Intergenic
978771350 4:112459228-112459250 CTGAAGAAGGATAAAGAACATGG + Intergenic
978853688 4:113368800-113368822 AGGAAGAAGGAGAAGGACCAAGG + Intronic
979193888 4:117897030-117897052 CAGCATAATGAGAAGAAACAGGG - Intergenic
979720575 4:123895293-123895315 CAGCAGAAGAAGGAAGAGCAAGG - Intergenic
979823112 4:125198633-125198655 CAGCAAAAGAAGAAGGAAGTGGG - Intergenic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980279000 4:130693618-130693640 CAGCAAAAGTAGAGGGAGCAAGG + Intergenic
980591097 4:134890649-134890671 CAGCAGAAGGAAAAGGTGCATGG + Intergenic
980878287 4:138684199-138684221 CAGGAGCAGAAGTAGGAACAGGG + Intergenic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981340084 4:143611531-143611553 CAGAAATATGAGAAGGAACAGGG + Intronic
981955570 4:150469052-150469074 AATCAGAAGGAGAAGGAAGTGGG - Intronic
982020424 4:151197680-151197702 CAGCAGAAGGGAAAGAAAAAAGG + Intronic
982204794 4:152989671-152989693 CAGCAGAAGAAGGAAGAACAGGG + Intergenic
982226244 4:153170127-153170149 AAGGAGAAGGAGGAGGAAGAGGG + Intronic
982277810 4:153654783-153654805 CAGCAGAAGGAAAGGCAAGATGG + Intergenic
983106828 4:163697015-163697037 CAGCAAAGGGAAAAGGCACAGGG + Intronic
983780674 4:171666456-171666478 CAGGAGCAGGAGAAAGAAAAAGG - Intergenic
983836140 4:172387743-172387765 CAGAAGAAGGTGAAGAGACAGGG - Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984440570 4:179764126-179764148 CAGCACAAGGTCATGGAACATGG + Intergenic
984781217 4:183527436-183527458 AAGGAGAAAGAAAAGGAACAAGG + Intergenic
984836190 4:184023939-184023961 CAGCTGAAGGAGAATAAACATGG - Intergenic
985345049 4:188995512-188995534 GAGCAGAAGCAGAAGGACAAAGG + Intergenic
985519553 5:367094-367116 AAGCATAAGCAGGAGGAACAAGG + Intronic
985559045 5:572815-572837 CAGCTGAAGGAGAACGACCTTGG + Intergenic
985690136 5:1304316-1304338 AAGGAGAAGGAGAAGGGAGAAGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
986067061 5:4245124-4245146 GAGAAGAAAGAGAAGGAAAACGG - Intergenic
986143531 5:5054502-5054524 CCACAGCAGGACAAGGAACATGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986350796 5:6877947-6877969 CTACAGAAGAAGAAGGAAGAGGG - Intergenic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
986634907 5:9811624-9811646 CAGAAGAAGAAGAAGAAAAAAGG - Intergenic
986676897 5:10193611-10193633 AAGAAGAAGAAGAAGAAACAGGG + Intergenic
987190887 5:15477204-15477226 GAGAAGAGGGAGAAGGAAAATGG - Intergenic
987367722 5:17164138-17164160 AAGGAAAAGGAGCAGGAACAGGG - Intronic
988025001 5:25674140-25674162 CAGGAGAGAGAGAATGAACAGGG + Intergenic
988461657 5:31444115-31444137 CAGCACACGGGGAAGGGACAGGG + Intronic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
989160249 5:38384117-38384139 GAGAGGAAGGAGAAGGAATAAGG + Intronic
989405430 5:41056173-41056195 CAGGAAAAGGAGAAGAGACATGG + Intronic
990182296 5:53174516-53174538 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
991392874 5:66167175-66167197 CATAAGAAGCGGAAGGAACAGGG - Intronic
991507400 5:67339556-67339578 AAGCAAAAGGAAAAGGAAAAGGG - Intergenic
991592011 5:68261883-68261905 CAGCAGAAAGGGAAGGGATAGGG - Intronic
992090649 5:73312971-73312993 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
992090684 5:73313135-73313157 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
992846442 5:80753832-80753854 CAGTGGAAGGAGAAAGAACAGGG + Intronic
993870641 5:93249945-93249967 CAGCAGAAAGAGATGGGAAAGGG + Intergenic
993897586 5:93556109-93556131 CTACAGAAGCAGAAAGAACATGG - Intergenic
994068208 5:95567472-95567494 CAGCAAAAGGACAGGGAATAAGG + Intronic
994343919 5:98663212-98663234 AAGCAGAGGGAGAAGGAAAGAGG + Intergenic
994647295 5:102485707-102485729 CAGCTGAGGGAAAAGGCACATGG - Intronic
995035147 5:107525709-107525731 GAGGAGAAGGAGAAAGAAGAGGG + Intronic
995695384 5:114873309-114873331 CAGCTGAAGCAGAAGGAATGGGG - Intergenic
995735854 5:115298386-115298408 GAGAAGAAGGAGAAGGGAGAAGG + Intergenic
995918705 5:117284142-117284164 CAGGAGAAGCAGATTGAACACGG - Intergenic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
996109672 5:119550433-119550455 AAGCAAAAGGAGAAGGAAAAAGG + Intronic
996304998 5:122036798-122036820 CAGCAAAGGGAAAAGGTACATGG - Intronic
996656095 5:125938386-125938408 AAGGCGAAGGAGAAGGAAGAAGG - Intergenic
996849679 5:127938084-127938106 CAGGAGTAGGAGAAGGAAAATGG - Intergenic
997370976 5:133359810-133359832 CAGCAGAACGGGTAGGAAAAGGG - Intronic
997815814 5:137016057-137016079 CAGAAGAAGGAGAAGGCCTAGGG + Intronic
998563284 5:143192331-143192353 CAGCAGCACCAGCAGGAACATGG + Intronic
998737404 5:145158377-145158399 GAGCAGAATGAGAAGAAACCTGG - Intergenic
998869370 5:146537139-146537161 CAGCAGAAGGTGCAGGTGCAGGG + Intergenic
998966631 5:147548213-147548235 CAGCAGAATGAGAAAGAAATAGG + Intergenic
999304360 5:150510034-150510056 CTGCAGAAGGGTAACGAACAGGG + Intronic
999891354 5:155981606-155981628 CAGCAGAAGTAGGAGGCACTGGG - Intronic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1000097375 5:157983900-157983922 GAGAGGAAGGAGAAGGAACAGGG + Intergenic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1002037806 5:176486339-176486361 CAGCAGCCTGAGAAGGAAAACGG - Exonic
1002093640 5:176818376-176818398 TAGCAGAAGGAGAATGAATTTGG - Intronic
1002098212 5:176844448-176844470 CAGCTGAGCGAGAAGGGACACGG + Intronic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002535834 5:179874871-179874893 CCCCAGCAGGAGAAGGAACCCGG + Intronic
1002809403 6:612728-612750 CAGCAGCAATAAAAGGAACAGGG + Intronic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1002971218 6:2022157-2022179 AACCAGAAGGACAGGGAACAGGG + Intronic
1002987749 6:2207274-2207296 AAGCAGAAGGTAAAGGCACAGGG + Intronic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003221298 6:4163260-4163282 CAACAGACTGAAAAGGAACAGGG - Intergenic
1003331651 6:5134853-5134875 GAGAGGAAGGAGAAGGAATAGGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004406021 6:15334569-15334591 CAGCAAAAGGAGCAAGCACATGG - Intronic
1004412976 6:15399017-15399039 CAGTAGAAGGAAGAGGAAAAAGG + Intronic
1004853910 6:19729688-19729710 CAAGAGAAGGAGAAAGAAAAGGG + Intergenic
1004919714 6:20365096-20365118 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1004920239 6:20369329-20369351 CAGGAAAAGGAGAAGGATCAGGG + Intergenic
1005434390 6:25792740-25792762 ATGCAGAAAGAGAAGAAACAAGG - Intronic
1005689349 6:28287224-28287246 CAAGAGAAGGGCAAGGAACATGG - Intronic
1005835004 6:29702335-29702357 CAGGAGCAGCAGCAGGAACAAGG + Intergenic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1007728954 6:43934133-43934155 CAGCAGAGGCACAAGGAACTGGG - Intergenic
1008192326 6:48475295-48475317 CAGCAGAAGGATAGGGTACAGGG + Intergenic
1008309746 6:49952309-49952331 CAGCAGGTGGAGAAGGAATGTGG - Intergenic
1008581707 6:52913980-52914002 CAGTGGAAGGAGATGGGACAAGG + Intergenic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009701311 6:67185501-67185523 CAGCAGAGAGAGCAGGAATAGGG - Intergenic
1009806657 6:68608206-68608228 CTTCAGAAGGATGAGGAACATGG - Intergenic
1010373705 6:75141425-75141447 CAGCAGACGGAGCAGGAAGCAGG + Intronic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1011125420 6:84002386-84002408 CAGCAAATGGGGAAGGAAGAGGG - Intergenic
1011967722 6:93180214-93180236 CAGCTGAAAGAGAAGGAGAAAGG - Intergenic
1012232525 6:96777215-96777237 AAGGAGAAGGAGAAGAAAGAGGG - Intergenic
1012437918 6:99234776-99234798 CAGCTGAAGGAGCAGGAGAAGGG - Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012788530 6:103661567-103661589 CAGCAGAAAGAAAAGGAGGAAGG - Intergenic
1013093406 6:106921605-106921627 AAGAAGAAGGAAAAGGAAAAGGG + Intergenic
1013233962 6:108180973-108180995 CTGGGGAAGGAGAAGAAACAGGG - Intronic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1013833715 6:114306968-114306990 CAGCAGCGGGTGAAGGATCATGG + Intronic
1014014408 6:116513587-116513609 CATCAGAATGAGAAGGACCTGGG + Intronic
1014528047 6:122524115-122524137 AAGGAGGAGGAGAAGGAAGAAGG - Intronic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1015054491 6:128883259-128883281 CAGCAGAAGGAGGAGGACCCCGG - Exonic
1015464805 6:133536993-133537015 AAGGATAAGAAGAAGGAACATGG - Intergenic
1015707283 6:136101938-136101960 CAGCAGAGAGAGAAGAAACATGG + Intronic
1015837048 6:137431699-137431721 TTGCAAAAGGAGAAGGAATAGGG + Intergenic
1016029475 6:139322767-139322789 CTACAGAAAAAGAAGGAACAAGG - Intergenic
1016325450 6:142896275-142896297 GAGCAGGAGGAGGAGGAAGATGG - Intronic
1016411578 6:143788750-143788772 CTGCAGGAGGACAAGGAAAAAGG - Intronic
1017293335 6:152766203-152766225 CAGCAGTAGGAGAAAGATGAAGG + Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017491808 6:154951878-154951900 AAGGAAAAGGAGAAGGACCACGG - Intronic
1017549597 6:155491950-155491972 CAGCAGAAGCAGAAGAAACAAGG - Intergenic
1017657598 6:156645142-156645164 CTGCAGAAGAACAAGGGACATGG + Intergenic
1017912762 6:158808442-158808464 CAGCAAAAGGACAAACAACAAGG + Intronic
1018038102 6:159898742-159898764 AGGGAGAAGGAGAAGGAACGAGG - Intergenic
1018282780 6:162206027-162206049 CGAGAGAAGGAGAAGGAAGAAGG + Intronic
1019830276 7:3321683-3321705 GAGGAGGAGGAGAAGGAAGAAGG - Intronic
1020465705 7:8476283-8476305 CAGCTGACAGAGAAAGAACAGGG - Intronic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020837606 7:13173629-13173651 CAGCAGAAGGACAGGGAAAGGGG - Intergenic
1020853169 7:13383143-13383165 AAAGAGAAGGAGAAGAAACATGG - Intergenic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022318391 7:29265175-29265197 CAGGAGAAGTTGAAGGAATAGGG - Intronic
1023097155 7:36672976-36672998 AAGCAGAAGAAGGATGAACACGG + Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023549759 7:41357237-41357259 TAGCAGAAGGAGAAGAAAAGAGG - Intergenic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1023800999 7:43834750-43834772 CAGGAAAAGGAAAAGGAAAAGGG - Intergenic
1024219367 7:47275964-47275986 CATCAGAAGGATAAGGAACCTGG + Exonic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024818266 7:53296097-53296119 CAGCAGTAGGACAAAGAACATGG + Intergenic
1026129192 7:67606369-67606391 CATCCTAAGGAGAAGAAACAGGG - Intergenic
1026245417 7:68615282-68615304 GAGAAGAAGGAGGAGGAAGAGGG + Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026905077 7:74058172-74058194 AAGCAGGAGGAGGAGGAAGAGGG - Intronic
1027129511 7:75581134-75581156 CAGCACAAGGGGTAGGAAAATGG - Intronic
1027640243 7:80724102-80724124 CTCCAGAATGAGAAGGAACATGG + Intergenic
1027893539 7:84009799-84009821 AAGTAGAAGGGGAAGGAAGAAGG + Intronic
1028203666 7:87992226-87992248 CAGAGGAAAGAGATGGAACAAGG + Intronic
1028328929 7:89563850-89563872 TGGCAGAAGGAGAAAGAACAAGG - Intergenic
1028599028 7:92580605-92580627 CAGCAAAAGGAAAAGGCACAGGG - Intronic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1028921374 7:96314101-96314123 AAGGAGAAGGAGGAGGAAGAAGG + Intronic
1029187135 7:98747256-98747278 TTGCACAATGAGAAGGAACAAGG - Intergenic
1029999748 7:105047003-105047025 CAGCAAAGGGAAAAGGTACATGG + Intronic
1030184032 7:106741920-106741942 TAGCAGAAGGATAAAGGACACGG - Intergenic
1030337635 7:108343223-108343245 CAGTAGAATTAGAAGGAAAAAGG + Intronic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031412867 7:121460972-121460994 CAGAAGAAAAAGAAGGAGCAGGG - Intergenic
1031537132 7:122948359-122948381 GAGGAGAAGGAGAAGGACAAGGG + Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031747249 7:125515863-125515885 CAGCAAAAGGATAAAGAAAATGG - Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032012027 7:128352891-128352913 GAGAAGTAGGAGAAGGAAGAGGG - Intronic
1032332175 7:130990779-130990801 CAGCAGAGGGAGATGGTGCAGGG - Intergenic
1032466805 7:132151292-132151314 AAGAAGAAGGAGGAGGAAGAAGG + Intronic
1032630421 7:133645010-133645032 CAGGTGAAGGAGGAGGAAAAGGG - Intronic
1032760206 7:134933487-134933509 CAAGAGGAGGAGAGGGAACAAGG + Exonic
1033611785 7:142970295-142970317 CAGCAAAAGGAGCAGGAAAAGGG + Intergenic
1033622068 7:143070383-143070405 GAGAAGAGGGAGAAGAAACAGGG + Intergenic
1033831904 7:145264986-145265008 CAGAAGCAGGACAAGGAATAGGG - Intergenic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1034413345 7:150952666-150952688 CTGCTGAAGGAGACGGAAGAAGG - Exonic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035378458 7:158423241-158423263 CAGCAGCAGGGGATAGAACATGG - Intronic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035521809 8:280627-280649 CAGCATAAGAAGGAGGAACAAGG + Intergenic
1035521868 8:281074-281096 AAGAAGACGGAGAAGGAAAATGG + Intergenic
1035682055 8:1495399-1495421 CAGCAGAAGGGGAAGAGAAAGGG - Intergenic
1035856639 8:2982832-2982854 CAACAGCTGGAGAAGGAACCTGG - Intronic
1036628806 8:10496123-10496145 GAGAAGAAAGAGAAGGAAAAAGG + Intergenic
1037151453 8:15640333-15640355 CAGCAGAGGGAAAAGGCACACGG - Intronic
1037189852 8:16110978-16111000 CAGAAGAAGGAAAAGAAAAAAGG + Intronic
1037300254 8:17444021-17444043 GAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1037966501 8:23138141-23138163 CAGCAGGAGGACAGGGAATAGGG - Intronic
1038037035 8:23695147-23695169 CAGCAGGAAGAGAAGGAAAGTGG + Intergenic
1038052986 8:23830872-23830894 AAGCAGCAGGAGCAAGAACAAGG + Intergenic
1038208171 8:25489186-25489208 CTGGAGAAGGAAAAGGAACTGGG - Intronic
1039003388 8:33006940-33006962 CAACAGGTGGAGAAGGAATAAGG - Intergenic
1039045330 8:33444362-33444384 CAGCATGGGGAGGAGGAACAAGG + Intronic
1039648523 8:39314661-39314683 AAGCACCAGAAGAAGGAACATGG - Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039805491 8:40994224-40994246 AAGAAGAAGAAGAAGGAACCGGG - Intergenic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041392917 8:57363063-57363085 TGGAAGAAGGAGAAAGAACATGG - Intergenic
1041566896 8:59288858-59288880 CAGCAGAAGGAGAGGCAATGTGG - Intergenic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1041861870 8:62523616-62523638 TAGGAGCAGGAGAAGGAAAATGG + Intronic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042482428 8:69319314-69319336 TAGAAGAGGGAGAAGGAAAAGGG - Intergenic
1042548990 8:69976208-69976230 CAGCATATAGAGAAGGAAAAGGG + Intergenic
1042798754 8:72693752-72693774 AAGCAGAAAGAGAAAGAACCAGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043137472 8:76546527-76546549 CTGTAAAAGGAGCAGGAACAGGG - Intergenic
1044039485 8:87348864-87348886 CAACAGAAAGAAAAGGAACAAGG + Intronic
1044337788 8:91008037-91008059 CAGCAAAAGGAAAAGGCAGATGG - Intronic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044973003 8:97638188-97638210 CAGTGGAAGGAGAAGGAACTAGG + Intergenic
1045370147 8:101514913-101514935 AAGGAGAAGAAGAAAGAACAAGG - Intronic
1045499398 8:102733431-102733453 CAGCAGCAGGAGCAGCAGCATGG + Intergenic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046574889 8:116015309-116015331 GAGCAGAAGGAGGAAGAAGAGGG - Intergenic
1047709549 8:127538128-127538150 CAGCAGCAGGAGATGGCACCTGG + Intergenic
1047798671 8:128285620-128285642 AAGAAGAAGGAGAAGGAAAAGGG + Intergenic
1048489643 8:134880665-134880687 AAGCTGGAGGAGAAAGAACAGGG + Intergenic
1048608827 8:135999800-135999822 CAGCAGATAGAGAAGGAAGTAGG - Intergenic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1048877537 8:138848859-138848881 CAGCAGGAGCAGTAGAAACAAGG + Intronic
1049269495 8:141686740-141686762 CCCCGGAAGGAGAAGGGACAGGG - Intergenic
1049325491 8:142019443-142019465 CAGCAGGAGGATCAGGAGCACGG - Intergenic
1049348861 8:142153415-142153437 CAGCAGAAGGTGCAGGAAAGTGG + Intergenic
1049543017 8:143216981-143217003 CAGCAGAAGGAGGAAGGAGAAGG - Intergenic
1049657822 8:143806528-143806550 CTGCAGAAGGAGCAGGAATGCGG - Intronic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1050764191 9:9112022-9112044 CAGCAAAATGAGAAGAAAAATGG - Intronic
1051780509 9:20684154-20684176 CAGCCGGAGGAGGCGGAACAGGG + Intronic
1052304749 9:26994614-26994636 CAGAAGAAGAAGGAGGTACATGG - Exonic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1054705838 9:68461237-68461259 TGGCAGAAGGAGAAAGAACATGG + Intronic
1055151893 9:73010401-73010423 CAGAAATAAGAGAAGGAACATGG - Intronic
1055266060 9:74497499-74497521 AAGAAGAGGGAGAAGGAACAAGG - Exonic
1055294021 9:74815597-74815619 CACCAGGAGGAGAAGGAAACTGG + Intronic
1055339251 9:75263794-75263816 AAGCAGAAGGAAAAGTAAAAGGG - Intergenic
1055407843 9:75993705-75993727 CAGCAGAAAGAAAACGCACATGG + Intronic
1055486878 9:76764810-76764832 CAGTGGAGGGAGAAGGATCATGG - Intronic
1055738879 9:79363969-79363991 CAGAAGAAAGAGTAGGAAGAAGG - Intergenic
1055932218 9:81571280-81571302 AAGCAGAAGGGGAAGGAAAAGGG + Intergenic
1056926035 9:90835186-90835208 CATCATAAGGAGGGGGAACAGGG + Intronic
1057543561 9:95999665-95999687 AAACAGAAAGAGAAGGAACTGGG - Intronic
1057739767 9:97701172-97701194 GAGCCGAAGGAGAAGGAGGAGGG - Intergenic
1057890257 9:98864578-98864600 CTGCAGATGGAGAAGGAAGGAGG - Intergenic
1058060675 9:100492625-100492647 GGGCAGTAGGAGAAGGAAAAAGG + Intronic
1058144132 9:101392156-101392178 CAGCAGAAGCAGTAGTAAGAGGG + Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058379080 9:104358945-104358967 CAGCAAATGGCTAAGGAACATGG + Intergenic
1058409458 9:104715263-104715285 AAGAAGAAGGAGAAGGAAAAGGG - Intergenic
1058563025 9:106249755-106249777 CAGCAGAAGAAGGAAGAAGACGG - Intergenic
1059160674 9:112032099-112032121 AAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059303397 9:113333957-113333979 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1059316252 9:113428185-113428207 CAGCAGCAGCAGATGGAAAAAGG + Exonic
1059581510 9:115554551-115554573 CAGCAGAAGGAAAAGTATCAAGG - Intergenic
1060188467 9:121577849-121577871 CAGCAGAGGGAGCAGGCACCAGG + Intronic
1060830241 9:126709201-126709223 TGGCAGAAGGTGAAGGAGCAAGG - Intergenic
1060922736 9:127433765-127433787 CATCACAAAGAGAAGAAACATGG - Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061638276 9:131929334-131929356 AAGCAGAAGGAAAAGTAAAAGGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1062564522 9:137158256-137158278 CAGGAGAAGGAGCAGGGAGAAGG + Intronic
1062604690 9:137341452-137341474 CAGCAAAGGGAAAAGGCACATGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1203704821 Un_KI270742v1:29992-30014 CTGTAGAAGAAGGAGGAACAGGG + Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1186149746 X:6661661-6661683 CATCAGAAAGAGATGGAAGAAGG - Intergenic
1186299835 X:8188194-8188216 AAGGAGAAGGAGTAGGAAGATGG + Intergenic
1186460676 X:9746090-9746112 CAGCAGCAGGGGCAGGTACATGG + Exonic
1186471165 X:9823094-9823116 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471172 X:9823126-9823148 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186542011 X:10410432-10410454 CAGCAAAGGGAAAAGGTACACGG - Intergenic
1186855707 X:13624164-13624186 CAGCAGCAGGAGAGTGAATATGG - Intronic
1187256564 X:17648366-17648388 CAGCAGAAGCAGAAGTTGCAAGG + Intronic
1187377907 X:18773592-18773614 CAGCAAAAAGAAAAGGAAAAGGG - Intronic
1187457926 X:19459158-19459180 CAGCAGAGGGGTTAGGAACAAGG + Intronic
1187596897 X:20783295-20783317 CAGCAGAAAGAAAAGCAAAAAGG - Intergenic
1187746652 X:22416374-22416396 TGGCAGAAGGGGAAGGAAAAAGG - Intergenic
1188206995 X:27372478-27372500 AAGGAGAGGGAGAAGGAAAAGGG - Intergenic
1188841702 X:35025030-35025052 GAGCAGAAGGAGAAGCAGCCAGG + Intergenic
1188988440 X:36788996-36789018 GAGCAGAAGGAGAAGCAGCCAGG - Intergenic
1189110821 X:38286846-38286868 GAGCAAAAGGAGAGGGAGCAGGG - Exonic
1189354818 X:40302496-40302518 GGGCAGAGGGAGAAGGAAAATGG + Intergenic
1189645890 X:43131021-43131043 CAGAAGCAGGAGAAAGAAGAAGG + Intergenic
1189683620 X:43541557-43541579 CAGCAGCAGGAGAAGCATCTGGG + Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189766567 X:44378334-44378356 CAGCAAAAGCAAAAGGCACATGG + Intergenic
1189961973 X:46332742-46332764 CACCAGAAGGAGAGGGAACCTGG + Intergenic
1190478722 X:50853233-50853255 CCTCAGAAAGAGAAGGAAAAGGG - Intergenic
1191105278 X:56768552-56768574 CAGCAGATGGAGAAAGATAAAGG - Intergenic
1191106271 X:56773954-56773976 CAGCAGATGGAGAAAGATAAAGG - Intergenic
1191107264 X:56779356-56779378 CAGCAGATGGAGAAAGATAAAGG - Intergenic
1191678366 X:63815426-63815448 CAGAGGAAGGTGAAGGAAAATGG - Intergenic
1191792967 X:64990695-64990717 ATACAGAAAGAGAAGGAACAGGG - Intronic
1192591563 X:72364235-72364257 AAGGAGACTGAGAAGGAACAGGG - Intronic
1192670439 X:73134857-73134879 CAGCAAAGGGAGAAGGCCCATGG + Intergenic
1192822409 X:74658637-74658659 AAGCAGAATGAGAAGTAAAAGGG - Intergenic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193857945 X:86628055-86628077 CAACAGCAGGAGGAGGAAAAAGG - Intronic
1194178222 X:90679221-90679243 AAGGAGAAAGAGAAGGAAAAGGG - Intergenic
1194746817 X:97637215-97637237 CAGCAGAAGGGAAAAAAACAGGG + Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1194954530 X:100163166-100163188 CAGCAAAAGCAGTAGGAAGAAGG - Intergenic
1195101609 X:101560594-101560616 AAAAAGAATGAGAAGGAACAAGG - Intergenic
1195244243 X:102981184-102981206 TAGAAGAAGGAGGAGGATCAGGG - Intergenic
1195461320 X:105128655-105128677 CAGAAGAAAAAGAAAGAACACGG - Intronic
1195668157 X:107449156-107449178 CAGCAGAAGGCGAGCAAACAAGG + Intergenic
1195973964 X:110505155-110505177 AAGGAGAAGGAGAAGGGAAAGGG - Intergenic
1196613338 X:117738867-117738889 TAGCAGAAAGAAAAGGAGCAGGG + Intergenic
1196731105 X:118942311-118942333 AAGGAGAAGGAGAAGAAAGAAGG + Intergenic
1198024002 X:132687248-132687270 CAGCAGAAGGGGAAGGGAGGAGG + Intronic
1198064228 X:133080445-133080467 CAGCAGAAAGACATGGAATAGGG + Intronic
1198965262 X:142221637-142221659 GAGCAGAAAGAGAAGGCAGAGGG + Intergenic
1198971804 X:142289926-142289948 CAACAGAAGCAGAAAGGACATGG - Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200401800 X:156024251-156024273 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1200414210 Y:2890861-2890883 AAGAAGGAGGAGAAGGAAGAGGG + Intronic
1200803100 Y:7404322-7404344 CAGGAGAATGAGAAAGAACACGG - Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic
1202107358 Y:21385103-21385125 CGGCAGAGGGAGGAGGAAAAGGG + Intronic