ID: 1045701292

View in Genome Browser
Species Human (GRCh38)
Location 8:104869873-104869895
Sequence CAGAGAAAGGAGCAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045701288_1045701292 21 Left 1045701288 8:104869829-104869851 CCTAATGGTATGTCTCTGAGGTT 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045701292 Original CRISPR CAGAGAAAGGAGCAGGAGCC AGG Intronic
No off target data available for this crispr