ID: 1045702432

View in Genome Browser
Species Human (GRCh38)
Location 8:104882111-104882133
Sequence TGACAGAAGCACCACCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 6, 3: 18, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045702432_1045702434 -8 Left 1045702432 8:104882111-104882133 CCCAGATGGTGGTGCTTCTGTCA 0: 1
1: 0
2: 6
3: 18
4: 183
Right 1045702434 8:104882126-104882148 TTCTGTCAGTCTATGAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045702432 Original CRISPR TGACAGAAGCACCACCATCT GGG (reversed) Intronic
902717127 1:18280583-18280605 TAGCAATAGCACCACCATCTAGG - Intronic
903193367 1:21668814-21668836 GGACAGGAGCGCCACCCTCTGGG + Intronic
904972367 1:34429051-34429073 TGACAGATGCATGACCATCAGGG + Intergenic
905727479 1:40265841-40265863 GGACAGCAGCAACAGCATCTGGG - Intronic
912473418 1:109921272-109921294 TGGCTGCAGCACTACCATCTAGG - Intronic
913479662 1:119275497-119275519 TGACAGAAGCTCCTCCTCCTAGG + Intergenic
915074249 1:153295818-153295840 TGACTGACGAACCTCCATCTTGG + Intergenic
915460203 1:156065984-156066006 CGACAGCCGCACCACCATCGGGG + Exonic
918770048 1:188545529-188545551 TGAAAGAAGCAACACCATAATGG + Intergenic
920167545 1:204046257-204046279 TGCCAGAATCACCACCAACCTGG + Intergenic
922859379 1:228803109-228803131 AGACAAAAGCAGCTCCATCTTGG + Intergenic
1063035866 10:2286147-2286169 TAACAGAGGCACCACCAAGTTGG - Intergenic
1063332022 10:5169250-5169272 GAACAGGAGCACCATCATCTCGG - Intergenic
1063862619 10:10328023-10328045 TGAGGGAAGCATCACCACCTTGG - Intergenic
1063987468 10:11520625-11520647 AGAAAGAAGGACCACAATCTGGG + Intronic
1064511032 10:16091621-16091643 TGACAGGTGCACCAAAATCTCGG + Intergenic
1067825356 10:49568248-49568270 TGGCAGAAACACTACCAGCTTGG - Intergenic
1069175474 10:65284229-65284251 TGACATAAGTGACACCATCTTGG + Intergenic
1070548281 10:77470014-77470036 TGACAGAAGGAGCAGAATCTTGG - Intronic
1072685674 10:97535159-97535181 TCACAGAGGCATCACCATCCAGG + Intronic
1074826389 10:117217985-117218007 TGTCTGAAGCACCACCTTCAGGG - Intergenic
1076657537 10:132034893-132034915 TGACAGAACAACCACAATCATGG + Intergenic
1077661148 11:4069666-4069688 TGACAGAAGCCACTACATCTTGG + Intronic
1079022494 11:16921050-16921072 TGTCTGAAACACCACCAGCTGGG + Intronic
1079100709 11:17540238-17540260 TGAAAGCATCACCACCATCAAGG + Intronic
1079270955 11:18985605-18985627 TCACAGAAAGACCACCACCTAGG - Intergenic
1079771999 11:24474329-24474351 TGACAGAAACACCTCCTACTAGG + Intergenic
1084459593 11:69289072-69289094 TCACAGAAGCAAGACCCTCTTGG + Intergenic
1085135185 11:74080712-74080734 TGAGAGAACAAGCACCATCTGGG - Intronic
1085393499 11:76194522-76194544 TGGCACAAGCACAACTATCTGGG + Intronic
1086401685 11:86465927-86465949 TGTCAGAATCAGAACCATCTGGG - Intronic
1087584528 11:100101656-100101678 TGACAGGTGCACCAAAATCTCGG - Intronic
1090737282 11:129621079-129621101 TGGCAGAAGCAGCATCACCTGGG + Intergenic
1091584237 12:1806808-1806830 GGACAGAAGCCCCAGCATCTGGG - Intronic
1092107877 12:5935942-5935964 AGAAAGAAGCACCACTATTTGGG + Intronic
1092757140 12:11774297-11774319 TGACAACAGCCCCACCACCTAGG + Intronic
1098523269 12:71457828-71457850 TGAGAGAAGCAGCAACAGCTTGG - Intronic
1101257015 12:102988701-102988723 TTAGAGAACCAGCACCATCTGGG - Intergenic
1101782506 12:107848471-107848493 GAGCAGAAGCATCACCATCTTGG + Intergenic
1102271719 12:111542279-111542301 GGAGTGCAGCACCACCATCTCGG + Intronic
1104141153 12:125986735-125986757 TGATAGGACCACCACAATCTGGG - Intergenic
1104247073 12:127053871-127053893 TGGCAGAACCACCATCAACTTGG - Intergenic
1108380678 13:49851293-49851315 AGACAGAAGTACTAACATCTAGG + Intergenic
1108410465 13:50141326-50141348 AGACAGCAGCACAAACATCTGGG + Intronic
1112155713 13:96815066-96815088 TGACAAAAGTACCACTAACTGGG + Intronic
1112364580 13:98745768-98745790 TAACAAAAGCACCACAAACTGGG - Intronic
1112682002 13:101777578-101777600 TCACAGATGCATCAACATCTGGG + Intronic
1113326054 13:109282284-109282306 TGGCAGAAGCACCCCCTGCTTGG - Intergenic
1116378798 14:44237704-44237726 TGACAAATCCACCACCATATAGG + Intergenic
1117206220 14:53446274-53446296 TGACAGAACCTCCACTATCTGGG + Intergenic
1118035863 14:61865168-61865190 TGACAGAAACACGATCCTCTGGG - Intergenic
1120488472 14:85145848-85145870 TAACAAAACCACCACCAACTGGG - Intergenic
1121955540 14:98209520-98209542 TAACATAAGCATCACCACCTTGG - Intergenic
1127337720 15:58006102-58006124 TGACAGATGCACCAAAATCTTGG - Intronic
1130156152 15:81351790-81351812 TGAGAGAAGCACCAGGATGTTGG + Exonic
1133401095 16:5487687-5487709 AGACATGAGCTCCACCATCTTGG - Intergenic
1135399481 16:22156288-22156310 TGCAAGAAGCACCACCATTTAGG - Exonic
1136631121 16:31489825-31489847 TGTCACAAGCGCTACCATCTGGG + Exonic
1138157152 16:54716376-54716398 TGACAGATGATCCACCATGTGGG - Intergenic
1138360355 16:56423081-56423103 TGACAAAGGCACCACCACATAGG + Intronic
1140085702 16:71794231-71794253 TGACAGAAGCACAATCATAGTGG - Intronic
1140973780 16:80039756-80039778 TAACAGAAACTCCACCATCTTGG + Intergenic
1141339857 16:83193117-83193139 TGACAGAATCATCAACATCCAGG + Intronic
1145758360 17:27409205-27409227 TGACAGAAGTGCCAGCCTCTTGG + Intergenic
1146742328 17:35297642-35297664 GAACAGGAGCATCACCATCTTGG + Intergenic
1148633492 17:49129937-49129959 AGACAGGAGCATCACCATCTTGG - Intergenic
1151213659 17:72562849-72562871 TGCAAGCATCACCACCATCTAGG + Intergenic
1151883794 17:76911490-76911512 TGCCAGACGCCCCACCATCTGGG - Intronic
1153781597 18:8499946-8499968 TGACAGTGGCATGACCATCTAGG + Intergenic
1155116487 18:22773425-22773447 TGACACAAGCACCTCCCACTAGG - Intergenic
1156134677 18:34023526-34023548 TGAGAGAAGAACCACCGCCTTGG - Intronic
1156619864 18:38837255-38837277 TGACATAAGCACGATGATCTAGG + Intergenic
1160880636 19:1318430-1318452 GGACAGCAGCAGCACAATCTTGG - Intergenic
1161236876 19:3202528-3202550 TGACTGCAGCAGTACCATCTCGG - Intronic
1161624862 19:5320342-5320364 TGACACAAGCACCATCCACTTGG + Intronic
1163086951 19:14988397-14988419 GAGCAGAAGCACCATCATCTTGG - Intronic
1165342629 19:35223819-35223841 TAACAGTAGCACCAGCCTCTTGG + Intergenic
1165402684 19:35612009-35612031 AGACAGACGCACCACCAGGTAGG - Intergenic
1167645171 19:50701898-50701920 TGATAACAGCACCACCATTTTGG + Intronic
1168215307 19:54920803-54920825 ACACAGCACCACCACCATCTTGG + Intergenic
928736419 2:34295997-34296019 TGGCAGGAGAATCACCATCTAGG + Intergenic
929582498 2:43091141-43091163 TGTCAGAAGCACCACCAGCTTGG - Intergenic
930606883 2:53502112-53502134 TTACAGAAACAACACCATGTGGG - Intergenic
931444938 2:62318883-62318905 TGACAGAAGCGCAACTACCTGGG - Intergenic
932045587 2:68345800-68345822 TGGCAGCAGCACCATCACCTGGG - Intergenic
932333510 2:70915152-70915174 TGACAAAAGCACCAAAATCAAGG - Intronic
935484119 2:103631851-103631873 TGACAAAAGTGCCTCCATCTTGG + Intergenic
935788996 2:106573903-106573925 TGACAGCATCAGCATCATCTAGG + Intergenic
936697358 2:114966292-114966314 TGACTGAAACACCTCCCTCTAGG - Intronic
937229201 2:120387644-120387666 AGACAGAAGCACCACAAACATGG - Intergenic
938813786 2:134878784-134878806 TATTAGAAGCACCACCAGCTTGG - Intronic
940007455 2:149020938-149020960 TGACAGAAATATCACCCTCTAGG + Intronic
942516016 2:176753924-176753946 TGTCAGAGCCTCCACCATCTGGG - Intergenic
944061829 2:195577917-195577939 GGACAGAAGCACCACAATCTTGG + Intronic
944835456 2:203574841-203574863 TAACAGAACCAGCACCATCATGG - Intergenic
945326835 2:208491949-208491971 GAGCAGAAGCACCATCATCTTGG - Intronic
947439595 2:230108122-230108144 TGACAGCATCAACACCATCCAGG - Intergenic
1170761866 20:19258151-19258173 TGATAGAAGCACCGCCATCCTGG + Intronic
1174329324 20:49805363-49805385 TGTCATAGGCAACACCATCTGGG + Intergenic
1174474177 20:50784167-50784189 CCACAGAAGCACCACCGGCTTGG - Intergenic
1174510479 20:51047759-51047781 GGACAAAAGTAGCACCATCTTGG - Intergenic
1174749030 20:53093463-53093485 GGAGAGCAGCACCACCATGTTGG - Intronic
1175261156 20:57675023-57675045 TGACAGAAACCCCTCCATATGGG - Intronic
1175772713 20:61633706-61633728 TGACAGGAGCACCTGCCTCTTGG + Intronic
1178193901 21:30320127-30320149 ACGCAGAAGCACCACCTTCTAGG - Exonic
1179959017 21:44758009-44758031 TGGCAGAAGCCCCACCAGCCTGG + Intergenic
1181745864 22:24954392-24954414 TGCCAGAACCACCAAGATCTGGG - Intronic
1182261885 22:29079044-29079066 TGAGGGAAGCACCGCCATCTTGG - Intronic
1183283704 22:36949090-36949112 GAGCAGAAGCATCACCATCTTGG - Intergenic
1183439410 22:37814987-37815009 GCACAGAGGTACCACCATCTTGG - Intronic
1184433115 22:44453247-44453269 TGACTGGAGCACCAACATCCCGG - Intergenic
954816454 3:53285187-53285209 AGCCAGAAGCATCTCCATCTCGG + Exonic
959563858 3:107814575-107814597 TGACAGAACCACCTCCTTCCTGG - Intergenic
960853185 3:122077080-122077102 AGAGAGAAGCAGCACCCTCTGGG - Intronic
962030987 3:131600077-131600099 TGGTAGAAGTACCAGCATCTGGG + Intronic
962713570 3:138107972-138107994 TGACATAAGCACCCCCACCATGG + Intronic
963886917 3:150593336-150593358 TGAGAGAAGCGCCACAAGCTAGG - Intronic
966478677 3:180380461-180380483 TGACAGAATCACTGACATCTAGG + Intergenic
969961459 4:10948606-10948628 TGAGAGAAGAGTCACCATCTAGG + Intergenic
970997330 4:22282441-22282463 TGACAGCAGCACCCCATTCTCGG - Intergenic
971227128 4:24764743-24764765 TGGCAGAAGCAATATCATCTTGG - Intergenic
972191060 4:36591320-36591342 TGAAAGTATCACCACCATCAAGG - Intergenic
976423896 4:84877624-84877646 TGACAGATGCCTCACCGTCTTGG + Intronic
979520131 4:121656359-121656381 TGTCAACAGCACCACCCTCTGGG + Intergenic
979906313 4:126298476-126298498 TGACAGAAGCACATTTATCTGGG + Intergenic
980548297 4:134298902-134298924 TGAAAGAATCTCTACCATCTGGG - Intergenic
985730114 5:1543001-1543023 TCCCAGAAGCTCCACAATCTTGG - Intergenic
985799422 5:1994589-1994611 TGTCCGAATCTCCACCATCTTGG - Intergenic
986076559 5:4343959-4343981 TGACAGGAGCACCAAAAGCTGGG + Intergenic
986202206 5:5588895-5588917 TGACAGAAGCTGCACCATCCAGG + Intergenic
986473386 5:8097869-8097891 TGACAGAAGCACCCAGATGTGGG + Intergenic
986667983 5:10119531-10119553 TGACACAATCACCTCCAACTAGG - Intergenic
988116240 5:26895385-26895407 TGAGAGAAGCACCACTATACAGG + Intronic
988873372 5:35415631-35415653 TCACAGAAACACCACAAGCTTGG - Intergenic
990613734 5:57485872-57485894 TTACAGCAGCACCAACAACTTGG + Intergenic
991263685 5:64692211-64692233 TGGCAGAAGCACCTCCAACAGGG + Intronic
991467616 5:66930282-66930304 TTACAGCAGCAACAACATCTTGG + Intronic
992293551 5:75304899-75304921 TGAGAGCAGCACCACCATCTTGG + Intergenic
992781823 5:80134950-80134972 TAACACAAGCACCACTAGCTTGG + Intronic
995271362 5:110223100-110223122 TGACTGCAGCACCAAGATCTTGG - Intergenic
995681524 5:114726110-114726132 GAATAGAAGCATCACCATCTTGG + Intergenic
996067628 5:119097181-119097203 TTATAGAAGGACCACCATTTAGG + Intronic
996082681 5:119272847-119272869 TGACAGAAACATCACCATGTTGG - Intronic
996999217 5:129739305-129739327 TGGCAGAAGCATCACAAACTGGG + Intergenic
998184803 5:139970219-139970241 AGAAGGAAACACCACCATCTTGG - Intronic
998533900 5:142911260-142911282 TGACAGAGGCAAGACCATGTAGG - Intronic
1000658311 5:163908648-163908670 TGACAGAAGCACTACCAACTTGG - Intergenic
1002277005 5:178110550-178110572 TGACAGAATGAACACCTTCTCGG + Intergenic
1005209758 6:23447118-23447140 TTACTGAAGCCCCACCATGTAGG + Intergenic
1006467260 6:34203078-34203100 CGACAGAAGCCCCGCCCTCTTGG - Intergenic
1013072823 6:106744324-106744346 GGACAGGAGCACCATCATCTCGG - Intergenic
1015546430 6:134366502-134366524 TTGCAGAAGCTCCACCATTTTGG - Intergenic
1016291494 6:142533198-142533220 TGACAGATGGATCCCCATCTAGG - Intergenic
1018126835 6:160690581-160690603 TGCCAGAAGCATCCCCAGCTTGG - Intergenic
1020586941 7:10080269-10080291 GAGCAGAAGCACCATCATCTTGG + Intergenic
1021457801 7:20848270-20848292 CAACAAAAGCACCACTATCTTGG - Intergenic
1022685766 7:32594800-32594822 TGTCAGAAACACCAGCCTCTTGG - Intergenic
1023329552 7:39100049-39100071 TGAGAGAAGCACTTCCATTTAGG - Intronic
1026362764 7:69617900-69617922 TGCCAGAATCACCACCATTTGGG + Intronic
1031498803 7:122485950-122485972 AAACAGATGCACCATCATCTGGG - Intronic
1034589009 7:152123180-152123202 AGACAGAAAAACAACCATCTTGG + Intergenic
1035321142 7:158030082-158030104 GGACAGAAGCAACATCACCTGGG + Intronic
1036184590 8:6612757-6612779 TCTCAGAGGCACCACCAGCTGGG - Intronic
1042450888 8:68944074-68944096 GGACAGAATCACCACCCTCAAGG - Intergenic
1045702432 8:104882111-104882133 TGACAGAAGCACCACCATCTGGG - Intronic
1048247908 8:132829586-132829608 TGACAGCATCAGCATCATCTGGG + Intronic
1048369808 8:133767454-133767476 AGGCAGAAGCAGCTCCATCTCGG + Intergenic
1049183591 8:141236613-141236635 TGACAAAATGACCATCATCTGGG + Intronic
1049682248 8:143924622-143924644 GGCCAGCAGCACCTCCATCTCGG + Exonic
1051092890 9:13431082-13431104 TGAAAGAAGCCCCATCATGTGGG - Intergenic
1051857564 9:21586386-21586408 TGACAGCAGTACTTCCATCTTGG - Intergenic
1051940643 9:22501582-22501604 TGGCAGAAGCACCACCAATTTGG - Intergenic
1057253503 9:93523928-93523950 CTACAGAAGCACCAGTATCTGGG - Intronic
1059989472 9:119851538-119851560 CTACTGAAGCCCCACCATCTTGG + Intergenic
1060761856 9:126259388-126259410 TGAAAGACAAACCACCATCTGGG - Intergenic
1061376075 9:130225635-130225657 TGAGAGCAGCACCCCCTTCTTGG + Intronic
1061429007 9:130519377-130519399 TGACAGCAGCCCCACCAGGTGGG - Intergenic
1061997950 9:134197142-134197164 TGACAGAAGCAGGACCTTCAAGG - Intergenic
1062059715 9:134488592-134488614 TGACAGAAGCACTTCCGTGTGGG - Intergenic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1186063679 X:5738768-5738790 GAACAGGAGCACCATCATCTTGG + Intergenic
1188571877 X:31596853-31596875 TGACAGCAGCAGCATCACCTGGG + Intronic
1189515578 X:41710916-41710938 GGACAGAGGCACCACCATCTGGG - Intronic
1190915927 X:54811083-54811105 AGCCTGAAGCACCACCACCTCGG + Exonic
1200407224 Y:2824873-2824895 ACACAGATGCACCACCACCTGGG + Intergenic