ID: 1045707492

View in Genome Browser
Species Human (GRCh38)
Location 8:104943087-104943109
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045707489_1045707492 13 Left 1045707489 8:104943051-104943073 CCAGAAGTGAAAAGTAAAACAAC 0: 1
1: 0
2: 1
3: 60
4: 561
Right 1045707492 8:104943087-104943109 CTACCTCAGCACATCTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr