ID: 1045707492 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:104943087-104943109 |
| Sequence | CTACCTCAGCACATCTACTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1045707489_1045707492 | 13 | Left | 1045707489 | 8:104943051-104943073 | CCAGAAGTGAAAAGTAAAACAAC | 0: 1 1: 0 2: 1 3: 60 4: 561 |
||
| Right | 1045707492 | 8:104943087-104943109 | CTACCTCAGCACATCTACTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1045707492 | Original CRISPR | CTACCTCAGCACATCTACTT TGG | Intronic | ||
| No off target data available for this crispr | |||||