ID: 1045715521

View in Genome Browser
Species Human (GRCh38)
Location 8:105039148-105039170
Sequence ATACTCCGTAATGGCATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33898
Summary {0: 1, 1: 10, 2: 685, 3: 8084, 4: 25118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045715521 Original CRISPR ATACTCCGTAATGGCATTGC TGG (reversed) Intronic
Too many off-targets to display for this crispr