ID: 1045716488

View in Genome Browser
Species Human (GRCh38)
Location 8:105052986-105053008
Sequence CAAGTTGGTTATTTGTAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045716486_1045716488 17 Left 1045716486 8:105052946-105052968 CCACTGACAATAGCTAAAAATCA 0: 1
1: 0
2: 2
3: 54
4: 649
Right 1045716488 8:105052986-105053008 CAAGTTGGTTATTTGTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045716488 Original CRISPR CAAGTTGGTTATTTGTAACT TGG Intronic
No off target data available for this crispr