ID: 1045719968

View in Genome Browser
Species Human (GRCh38)
Location 8:105097637-105097659
Sequence AACTGCTCACAGGTACTTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045719968 Original CRISPR AACTGCTCACAGGTACTTTC GGG (reversed) Intronic
902680472 1:18040647-18040669 AGCTGCTTACAGGTATTTGCAGG - Intergenic
905981350 1:42231651-42231673 AACGGCTGAGAGGTACTTTTTGG - Intronic
908476299 1:64492021-64492043 AACTAGTGAAAGGTACTTTCAGG - Intronic
917133304 1:171763889-171763911 ATCTTTTCACAGGGACTTTCTGG + Intergenic
922696602 1:227734022-227734044 CCCTCCTCACAGGGACTTTCCGG - Exonic
923015566 1:230124199-230124221 AAGTACTGATAGGTACTTTCTGG + Intronic
923825912 1:237500420-237500442 ATCTGCTCATAGATAATTTCTGG + Intronic
1065696246 10:28382823-28382845 AACTGCACAAAGCTCCTTTCTGG - Intergenic
1068095079 10:52481241-52481263 CACTGCTCTCAGGCTCTTTCAGG + Intergenic
1070935654 10:80292956-80292978 AACTGCTCAGTGGGACTTACAGG - Intergenic
1073567884 10:104551060-104551082 GACTTCACACAGGTAATTTCTGG - Intergenic
1075971633 10:126659269-126659291 AACTCCTCACTGATGCTTTCTGG - Intronic
1076779386 10:132715781-132715803 AACAGCTCACAGGCTCTTGCTGG + Intronic
1081662878 11:44899104-44899126 AACTGCTCTCCAGTGCTTTCCGG + Intronic
1086956591 11:92940075-92940097 AACTGTGCACAGGTACTTACTGG + Intergenic
1090656232 11:128847988-128848010 AGCTGGTCTCAGGTACTTTGAGG - Intronic
1090975609 11:131677685-131677707 TATTGCTCATAGGAACTTTCTGG - Intronic
1091887357 12:4026323-4026345 AACTGCACACAGGCACCTACTGG - Intergenic
1097633676 12:62095870-62095892 AAATGCTCACAGAGGCTTTCTGG - Intronic
1099253599 12:80288942-80288964 AAATGATCACAGCTCCTTTCAGG - Intronic
1099266793 12:80456913-80456935 AATTGCTCAAAGCTACTATCTGG + Intronic
1100274636 12:93061084-93061106 AACTGCTCTCATCTGCTTTCTGG - Intergenic
1101016247 12:100503503-100503525 CACTGTTCACAGGTGCTTTCAGG + Intronic
1101693365 12:107101759-107101781 AACTGTTCACAAGTACATTCTGG - Intergenic
1102119375 12:110428986-110429008 AACTGTTCAGAGGTAGTTTGTGG + Intergenic
1102767401 12:115445472-115445494 AAGTCCTCACAGGTAATTCCAGG - Intergenic
1106838170 13:33658744-33658766 AGCAGCTCCCAGGTAGTTTCAGG + Intergenic
1107292782 13:38875703-38875725 AATTGTTCAGAGCTACTTTCTGG - Intronic
1107371827 13:39759089-39759111 GACAGCTAACAGGTACTTTTTGG + Intronic
1108507151 13:51122724-51122746 GACTGGTCACAGGTTATTTCAGG - Intergenic
1114208582 14:20596870-20596892 AAGTGCTCAAAGGTAGCTTCTGG - Intronic
1116521246 14:45849910-45849932 AATTGGTCACAGGGACATTCAGG - Intergenic
1119162482 14:72464584-72464606 AAATGATCACAGGTTCTCTCTGG + Intronic
1120058547 14:79954274-79954296 CACTTTTCACAGGTACGTTCAGG + Intergenic
1120754417 14:88228899-88228921 AACTTTTTTCAGGTACTTTCAGG + Intronic
1123739384 15:23220989-23221011 AAACTCTCACAGTTACTTTCTGG + Intergenic
1124290603 15:28449941-28449963 AAACTCTCACAGTTACTTTCTGG + Intergenic
1124292633 15:28467605-28467627 AAACTCTCACAGTTACTTTCTGG - Intergenic
1126485761 15:49178716-49178738 AACTGCATACAAGTACATTCAGG - Intronic
1127616421 15:60690461-60690483 CTCTGCTCACAGGTCCTGTCTGG - Intronic
1130606716 15:85324269-85324291 TATTTCTCACAGGTACTTTTAGG - Intergenic
1131839939 15:96426380-96426402 AAATGCTCACAGGGGCTTGCTGG + Intergenic
1135877189 16:26213558-26213580 AATAGCCCACAGGAACTTTCTGG - Intergenic
1139540191 16:67609274-67609296 ATCTGCTCTCAGTTATTTTCAGG + Intronic
1141067179 16:80923514-80923536 AACGGCACACAGCTACTTCCTGG - Intergenic
1142787935 17:2239076-2239098 AACTACTTACAGGTAGTTTGAGG - Intronic
1143292809 17:5844436-5844458 AACTGCTTTCAGATACTTGCTGG - Intronic
1147678968 17:42227176-42227198 AAATGCACAGAGGTACTTACTGG + Intronic
1148528098 17:48361981-48362003 GACTTCTCACAGATATTTTCAGG - Intronic
1151452662 17:74208191-74208213 AACTGCTCAGAGATACTCCCAGG - Intronic
1155042807 18:22079087-22079109 AACTGCACACATGTTTTTTCTGG + Intergenic
1155330415 18:24710251-24710273 AAATCCACACAGGAACTTTCAGG - Intergenic
1158686457 18:59619366-59619388 GACTGTTCACAGGTACAATCAGG + Intronic
1159967154 18:74606122-74606144 AACTGCTCTCATTTATTTTCTGG - Intronic
1161760546 19:6168010-6168032 AGGTGCTCACAGGCACTCTCTGG - Intronic
1162027940 19:7904722-7904744 AACTGGTCACAGGGATTTGCGGG - Intronic
1165002868 19:32779344-32779366 AACCGCTTACTGGTACTTACAGG - Intronic
1165786541 19:38465078-38465100 AACTGCTCACCTATAATTTCAGG - Intronic
926958651 2:18330608-18330630 AACAAATCACAGGTACATTCAGG - Intronic
930402135 2:50903773-50903795 AATGGCTCAAAGGTACTTTCAGG + Intronic
931077926 2:58736877-58736899 AGATGCTCACTGGTACTTTCAGG + Intergenic
935244459 2:101206149-101206171 AGCTGCTCCCAGGAAGTTTCTGG - Intronic
937336674 2:121066484-121066506 AACTTCACACAGGTACTGGCAGG - Intergenic
939648470 2:144731523-144731545 AACTGTGCATAGGGACTTTCAGG - Intergenic
940044020 2:149390378-149390400 AAATGCTCACTGGTTCTTACTGG + Intronic
944542489 2:200767012-200767034 ACCTGCTCAGAGGTATTTACGGG + Intergenic
945158284 2:206862072-206862094 AACTGCTTACTAGAACTTTCTGG - Intergenic
945791720 2:214313300-214313322 AACTTCACAAAGGTCCTTTCAGG - Intronic
945998628 2:216462197-216462219 AACTGCTGAGAAGCACTTTCAGG - Intronic
948154579 2:235771097-235771119 AACTGCTCACCTGTAGTCTCTGG + Intronic
1174681296 20:52411236-52411258 AATTGCTGACAGGTAGTTTGGGG + Intergenic
1175239685 20:57537921-57537943 AAGTGCTTACAAGTACTTTCAGG - Intergenic
1175412485 20:58779770-58779792 AGCTGCTTACAGGTGATTTCAGG - Intergenic
1178242789 21:30922069-30922091 AAATGATCACAGGGACTTTAAGG - Intergenic
1178392623 21:32211682-32211704 AACTTCTCATTGGTAGTTTCTGG + Intergenic
1180108030 21:45632772-45632794 CACTGGAAACAGGTACTTTCTGG + Intergenic
1180961421 22:19764059-19764081 AACTTCTCAAAGGCACTTTTAGG + Intronic
1184010744 22:41746112-41746134 GACTGCTCAAAGGAACTCTCTGG + Intronic
950910747 3:16588260-16588282 TACTGTTCACAGGTACTTGTTGG + Exonic
953221816 3:40978642-40978664 CAATGCTCACAGCTATTTTCAGG + Intergenic
954210157 3:49092353-49092375 AACTGTGCACAGATACTTCCAGG + Intronic
957391825 3:79584316-79584338 AACTGCTCAACAGTACTTTAGGG - Intronic
958497321 3:94862081-94862103 AATATCTCACAGGTACTCTCTGG + Intergenic
959473072 3:106776476-106776498 CACTGCTCACAGTTAGTCTCAGG + Intergenic
962215956 3:133521987-133522009 AACTGCCCCCAGATACTTCCTGG + Intergenic
962247173 3:133805522-133805544 AACTCCTCAGTGGTAGTTTCGGG + Intronic
962414423 3:135169121-135169143 AAATGCTCACAGCTACCTTTTGG + Intronic
967342427 3:188414333-188414355 AAATGCTCACAGGAACATTTTGG + Intronic
970929673 4:21494957-21494979 ACCTGCTCACCTGTACTTCCAGG - Intronic
971094659 4:23387184-23387206 AACTGTTCACAGTTCCTTTTGGG - Intergenic
971774144 4:30939106-30939128 AAGTGCTCCCAGGGATTTTCAGG - Intronic
973310724 4:48706841-48706863 AACAGGTCTCAGGTTCTTTCTGG - Intronic
973562335 4:52149641-52149663 AACTGCTCAGAGGCATTTTCAGG - Intergenic
974011968 4:56615335-56615357 GACTGATCGCAGGTACTTTGGGG - Intergenic
977972970 4:103232359-103232381 AATTGCTCCCAGCAACTTTCTGG - Intergenic
981018824 4:140004030-140004052 GACTGCACACAGGCACTTTAAGG + Intronic
983167234 4:164493017-164493039 AACTGTTCACAGCTGCATTCTGG - Intergenic
985011426 4:185586693-185586715 TATTGCTTACAGATACTTTCAGG + Intronic
985726907 5:1521317-1521339 AAATGCTCACAGGTAAATGCAGG + Intronic
987960570 5:24803310-24803332 AACTGATCATAGGTACCTTTAGG - Intergenic
989543000 5:42639919-42639941 AATTGCTCTCAGGTAATTTCTGG - Intronic
991183581 5:63782748-63782770 TGCTGGTCACAGGAACTTTCAGG + Intergenic
995879879 5:116832494-116832516 AACTGCTCACAGTTTCTTCCTGG - Intergenic
996559414 5:124812881-124812903 ATCTGCTCACTGGCACTTCCTGG - Intergenic
996773921 5:127114329-127114351 AACTGCTTTCAGATTCTTTCAGG + Intergenic
996784905 5:127228176-127228198 AGATTCTCACAGGTAGTTTCAGG + Intergenic
998366404 5:141635438-141635460 AAATGCACACAGGTACATACAGG + Intronic
1001422933 5:171600767-171600789 TTCTGCTCACTGGCACTTTCTGG + Intergenic
1002823207 6:748338-748360 AATTGCTAAGAGGTACATTCTGG - Intergenic
1007993568 6:46282762-46282784 AACTGCTTTCAGGTCCTTCCTGG + Intronic
1008107866 6:47459968-47459990 ATCTACTCAAAAGTACTTTCTGG - Intergenic
1012473862 6:99600782-99600804 AACTGCTCACAGGTTCTCCCAGG + Intergenic
1014164248 6:118205496-118205518 CACTGCTAACACTTACTTTCTGG - Intronic
1016270775 6:142287992-142288014 AGCTGCTAATAGGTAGTTTCAGG - Intergenic
1018721329 6:166575030-166575052 CACTGCTCCCAGATAATTTCAGG + Intronic
1019851638 7:3564733-3564755 AAATTCTCTCAGGTGCTTTCTGG - Intronic
1019910479 7:4097452-4097474 ACCTGCTCACAGGCGCTTCCTGG - Intronic
1027004226 7:74678698-74678720 CACTGCTTCCAGGTACTGTCAGG - Intronic
1030521816 7:110607060-110607082 AATTGCTCACCGTTATTTTCTGG + Intergenic
1031632013 7:124054883-124054905 AACTGCTTCTAGGTCCTTTCAGG - Intergenic
1036568464 8:9958530-9958552 TACTTCTCACAGCAACTTTCAGG - Intergenic
1036698663 8:10996363-10996385 TACTGCTCCCAGGTAATTTGAGG + Intronic
1038928376 8:32165878-32165900 ATGTGCTCACAGGTGCTTTCGGG - Intronic
1039127957 8:34225323-34225345 ATATGCACGCAGGTACTTTCTGG + Intergenic
1039450554 8:37671433-37671455 CACTGCGCCCAGCTACTTTCTGG - Intergenic
1039739765 8:40372019-40372041 TACAACTCACAGGTTCTTTCTGG - Intergenic
1045719968 8:105097637-105097659 AACTGCTCACAGGTACTTTCGGG - Intronic
1051763103 9:20490545-20490567 ATCTGCTCCCAGGTTCATTCAGG - Intronic
1052278379 9:26704460-26704482 AACTGCACACAGGTGGATTCTGG - Intergenic
1056125279 9:83530731-83530753 AAATGATCACAGGGACTTCCAGG + Intronic
1057874180 9:98740977-98740999 AACTGTTCACTGGCTCTTTCCGG + Intronic
1059131776 9:111759443-111759465 TACTGCTAACAGTTAATTTCTGG + Intronic
1059623745 9:116038092-116038114 AACGGGTCACAGGTACACTCTGG + Intergenic
1187665903 X:21609163-21609185 CACTGCTCCCAGTTACTTCCTGG - Exonic
1190780687 X:53592114-53592136 AACTGTCCTCAGTTACTTTCTGG - Intronic
1197731284 X:129812463-129812485 AACTGTTCACAGGTCCTTAAAGG - Intronic
1201142885 Y:11043045-11043067 CACTGCTCAGAGGAAGTTTCAGG - Intergenic
1201363096 Y:13174883-13174905 AACTGCTCTCAGTTCCATTCAGG - Intergenic
1202276855 Y:23130748-23130770 TACTGTTCACAGGTACTTCTTGG + Exonic
1202289173 Y:23289941-23289963 TACTGTTCACAGGTACTTCTTGG - Exonic
1202429847 Y:24764462-24764484 TACTGTTCACAGGTACTTCTTGG + Exonic
1202440945 Y:24905625-24905647 TACTGTTCACAGGTACTTCTTGG - Exonic