ID: 1045720985

View in Genome Browser
Species Human (GRCh38)
Location 8:105110655-105110677
Sequence ATCTCTCATCTATTGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2722
Summary {0: 1, 1: 14, 2: 93, 3: 700, 4: 1914}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045720985 Original CRISPR ATCTCTCATCTATTGCTGGT GGG (reversed) Intronic
Too many off-targets to display for this crispr