ID: 1045724357

View in Genome Browser
Species Human (GRCh38)
Location 8:105154524-105154546
Sequence ATCTAATTGTTTAGGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045724354_1045724357 20 Left 1045724354 8:105154481-105154503 CCATTTTTAAGAGCTTTCCTCTA 0: 1
1: 2
2: 1
3: 25
4: 325
Right 1045724357 8:105154524-105154546 ATCTAATTGTTTAGGAAAGATGG No data
1045724355_1045724357 3 Left 1045724355 8:105154498-105154520 CCTCTATTTTAAAACTCAATGAA 0: 1
1: 1
2: 1
3: 44
4: 459
Right 1045724357 8:105154524-105154546 ATCTAATTGTTTAGGAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045724357 Original CRISPR ATCTAATTGTTTAGGAAAGA TGG Intronic
No off target data available for this crispr