ID: 1045734004

View in Genome Browser
Species Human (GRCh38)
Location 8:105274262-105274284
Sequence CCCACCTCTTCAGAGATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045734004_1045734006 15 Left 1045734004 8:105274262-105274284 CCTCAGATCTCTGAAGAGGTGGG 0: 1
1: 0
2: 0
3: 32
4: 289
Right 1045734006 8:105274300-105274322 GCTCATATCTTACTATCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045734004 Original CRISPR CCCACCTCTTCAGAGATCTG AGG (reversed) Intronic
900490895 1:2948651-2948673 CCCAGCTCTCCAGAAAGCTGGGG + Intergenic
900682804 1:3926102-3926124 CCCACCACTTCTTAGCTCTGTGG - Intergenic
900994527 1:6113306-6113328 CCCACCTGTTCAGGAAGCTGAGG + Intronic
902077399 1:13798745-13798767 CCCACCCCTTAAGAGATGTCAGG - Intronic
902894233 1:19467895-19467917 CACAGCTCTTGAGAGCTCTGCGG - Intronic
904710195 1:32424555-32424577 TCAACCTCCTCAGGGATCTGTGG + Intergenic
904763411 1:32821748-32821770 CCCAGCTATTCAGAAGTCTGAGG - Intronic
905189381 1:36221923-36221945 CCCAGCTATTCAGAAAGCTGAGG - Intergenic
905660058 1:39715023-39715045 ACCTCTTCCTCAGAGATCTGAGG + Intronic
906775155 1:48522657-48522679 CTCACCTCTCCAGAGGTCTCTGG + Intergenic
907472810 1:54685435-54685457 CTCCACTTTTCAGAGATCTGAGG + Intronic
908083937 1:60610370-60610392 CCCAACTGCTGAGAGATCTGAGG + Intergenic
908846596 1:68330840-68330862 CCTAGCTATTCAGGGATCTGAGG - Intergenic
909538542 1:76765678-76765700 CCCACATCTTCACATACCTGAGG - Intergenic
909590103 1:77338666-77338688 ACCCCCACTTCAGGGATCTGAGG + Intronic
909649642 1:77959762-77959784 CCCACCTATTCAGAAGTCTGAGG - Intronic
910362990 1:86433302-86433324 GTCATCTCTTCACAGATCTGGGG + Intronic
910609517 1:89126703-89126725 CCCACCTATTCAGAAGGCTGAGG - Intronic
911011290 1:93283622-93283644 CCCAGCTATTCAGAAAGCTGAGG + Intergenic
914756114 1:150562387-150562409 CCCACCTCCTGAGAGGTCAGAGG - Intergenic
915761914 1:158322518-158322540 CCCACCACTTTAGAAAGCTGAGG - Intergenic
916498951 1:165369967-165369989 TTCACCTCTTCTGAGAGCTGTGG + Intergenic
917523368 1:175766285-175766307 CTCTCCTCTCCAGAGACCTGGGG + Intergenic
917543283 1:175936316-175936338 CCCACCCATTCTGACATCTGGGG + Intergenic
918433603 1:184487461-184487483 CCCACTTCTTAAGTGAACTGGGG - Intronic
919675744 1:200380827-200380849 CCCACCTCTTCATCTTTCTGTGG - Intergenic
920066095 1:203270817-203270839 GCCACCTCATCAGAGTTCTAAGG + Intronic
922675833 1:227548272-227548294 CCACCCTCTGCAGAGCTCTGTGG - Intergenic
923098179 1:230792252-230792274 TTCCCCTCTTCAGAGATTTGTGG + Intronic
923229298 1:231969460-231969482 CCCATCACTTCTGAGATTTGGGG + Intronic
923812017 1:237329296-237329318 CCCAACTATTCAGAGGGCTGAGG - Intronic
924554945 1:245110266-245110288 CCCAGCTACTCAGAGAGCTGAGG + Intronic
924919041 1:248606686-248606708 TCCACCTCTCCAGAAATCTTTGG - Intergenic
1063224914 10:4006556-4006578 CCCACCTCTTCAGGAGTCTGAGG - Intergenic
1064148559 10:12844030-12844052 CCCAGCTACTCAGGGATCTGAGG + Intergenic
1064351007 10:14576409-14576431 CCCAGCTATTCAGAAGTCTGAGG + Intronic
1064533780 10:16336983-16337005 CCCAGCACTTTAGAGACCTGAGG - Intergenic
1067382774 10:45790190-45790212 CCAAGCTGTGCAGAGATCTGGGG + Intronic
1067890479 10:50130735-50130757 CCAAGCTGTGCAGAGATCTGGGG + Intronic
1069275499 10:66586663-66586685 CCCAACACTGCAGAGAGCTGGGG - Intronic
1069771482 10:70903324-70903346 CCAACCTCTTCAGTGCTCTCAGG - Intergenic
1071677968 10:87674278-87674300 CCCAGCTACTCAGAGAGCTGAGG - Intronic
1072309684 10:94142401-94142423 CCCACCTATTCAGAAGGCTGAGG + Intronic
1072417320 10:95260034-95260056 CCCATCACTTCTGAGAACTGGGG - Intronic
1072899141 10:99392040-99392062 CCCACTTCTTTAAAGCTCTGGGG - Exonic
1073798090 10:107010707-107010729 CCAACTTATTCAGAGATCTGAGG - Intronic
1076698047 10:132256610-132256632 CCCACCTCTCCAGCGGTTTGGGG - Intronic
1077451740 11:2652480-2652502 CCCACCTCTCCAGAGGTTTCTGG + Intronic
1077740175 11:4837460-4837482 CCCAACACTTCAGAAAGCTGAGG - Intronic
1080873601 11:36258041-36258063 CCCTTCTCTTTAGAGCTCTGCGG - Intergenic
1081671326 11:44944241-44944263 CCCACCTCCTCAGAAAGCTGTGG + Intronic
1083527182 11:63379845-63379867 CCCAGCTCTTCAGAAGGCTGAGG - Intronic
1083860876 11:65419307-65419329 CCCCGCTCACCAGAGATCTGAGG - Intergenic
1084105213 11:66976337-66976359 CCTACCTCTTCACAGCTCTCTGG + Exonic
1084965302 11:72741414-72741436 CCCACACCTACAGAGACCTGGGG + Intronic
1085551142 11:77373442-77373464 CCCAGCTATTCAGAGGGCTGGGG + Intronic
1086343072 11:85867169-85867191 CCCAGCTACTCAGAAATCTGAGG - Intronic
1089474717 11:118749705-118749727 CCCACCTCTTGCGAGATAAGAGG - Exonic
1090758051 11:129812343-129812365 CCCAGCTACTCAGAGGTCTGAGG + Intergenic
1092218691 12:6699126-6699148 CCCAGCTATTCAGAGGGCTGAGG + Intronic
1094266504 12:28565990-28566012 CCCACCTCTCCAGAGACTAGAGG - Intronic
1094577301 12:31699032-31699054 CCCACCTCGCCAAAGGTCTGTGG - Intronic
1094700441 12:32865257-32865279 CCCAGCTCTTCAGAAGGCTGAGG + Intronic
1096653038 12:53071463-53071485 TCTACCTCCTCAGAGCTCTGAGG - Intronic
1096819632 12:54223834-54223856 CCCAGCTACTCAGAGAGCTGAGG - Intergenic
1097111239 12:56659836-56659858 CCCAGCTACTCAGAGAGCTGAGG + Intergenic
1097974090 12:65666254-65666276 CCCAGCACTTCAGGGAGCTGAGG + Intergenic
1099901700 12:88718635-88718657 CCCAGCTCCTCAGAAAGCTGAGG - Intergenic
1100177494 12:92047620-92047642 CCCACTCCTTCTGAGATGTGTGG + Intronic
1101136995 12:101754031-101754053 CCCAGCTCTTCAGGAAGCTGAGG + Intronic
1101328845 12:103740882-103740904 CACAACTCTTCAGAGTTCTGGGG - Intronic
1102077725 12:110073378-110073400 TCAACCACTGCAGAGATCTGGGG + Intronic
1102633548 12:114302567-114302589 CCCCCCACTTCTGTGATCTGAGG - Intergenic
1102752753 12:115310020-115310042 CCCAGCTCTTCAGGGGGCTGAGG - Intergenic
1102959395 12:117082386-117082408 CCCAGCTATTCAGAGGGCTGAGG + Intronic
1103357550 12:120332724-120332746 CACACCTGTGCAGGGATCTGGGG - Intergenic
1103717031 12:122950734-122950756 CCCCCCTCCTCAGAGAACAGGGG + Intronic
1104059307 12:125254171-125254193 CCCAGCTATTCAGAAAGCTGAGG + Intronic
1104203437 12:126614386-126614408 CCCACATCGTGAGAGATATGAGG + Intergenic
1105209035 13:18247147-18247169 CCAGACTCTTCAGAGATCTGTGG + Intergenic
1105298921 13:19116357-19116379 CCCACTTCTTCAGCAATCTCTGG - Intergenic
1106333567 13:28762809-28762831 CGCTCCTCCTCAGAGACCTGTGG - Intergenic
1107738494 13:43423679-43423701 CCTACCTCTGCAGTGATATGTGG + Intronic
1108136989 13:47375174-47375196 AGCAGATCTTCAGAGATCTGTGG - Intergenic
1109078241 13:57865127-57865149 CCCTCCTGTGCAGAGATCTTGGG + Intergenic
1110515289 13:76404506-76404528 CCCAGCACTTCAGGGGTCTGAGG - Intergenic
1115920614 14:38368213-38368235 CCCACCTCAGCAGAGTCCTGTGG - Intergenic
1117222586 14:53620706-53620728 CCCACCTCTTCAGAAAGCCCAGG + Intergenic
1119355141 14:73999970-73999992 CCCAGCTATTCAGGGGTCTGAGG + Intronic
1119471958 14:74906006-74906028 CCCAGCTTTTCAGAGACCAGAGG + Exonic
1121474239 14:94180726-94180748 CCCAGCTATTCAGAAAGCTGAGG - Intronic
1122680274 14:103455096-103455118 CAAACCTCTTAAGAGATTTGTGG - Intronic
1123152932 14:106200056-106200078 TCCACCTGTCCAGAGCTCTGGGG + Intergenic
1123798152 15:23794423-23794445 CCCACATCTGCTGAGAGCTGTGG - Intergenic
1124425302 15:29558133-29558155 CTCCCCTCCCCAGAGATCTGGGG + Intronic
1125461686 15:39913427-39913449 CCCATCTATTCAGAGGGCTGAGG + Intronic
1126986224 15:54312769-54312791 CCCCCTTTATCAGAGATCTGGGG - Intronic
1128303557 15:66582692-66582714 CCCAGCTATTCAGAAAGCTGAGG - Intronic
1128394786 15:67213400-67213422 GCCACCTCTTTACAAATCTGAGG + Intronic
1131700018 15:94925182-94925204 CCCAGCTACTCAGGGATCTGAGG - Intergenic
1132074251 15:98806421-98806443 CCCACCTCTGCTGGCATCTGTGG + Intronic
1132796306 16:1724999-1725021 CCCACCTCTTCACACTGCTGAGG + Intronic
1132913012 16:2325376-2325398 CCCACCTGTGCAGAGCTGTGAGG - Intronic
1133932398 16:10243066-10243088 CCCACCTCTTCTGTGATTTTGGG - Intergenic
1134257835 16:12626266-12626288 CCCACCACTTTGGAAATCTGAGG + Intergenic
1134445518 16:14328221-14328243 ACCACCTCATCAGAGAGCTCAGG + Intergenic
1134803228 16:17104564-17104586 ACCACCTCTCCAGAGAGCAGAGG + Exonic
1136365781 16:29808557-29808579 CCCCCCTCCTCAGAAATGTGAGG + Exonic
1136864747 16:33738061-33738083 CCCTCTTCTGCAGGGATCTGTGG + Intergenic
1137755074 16:50894642-50894664 GCCACCTCTTAAGAAGTCTGAGG + Intergenic
1138625927 16:58251505-58251527 CCCAGCTATTCAGGGGTCTGAGG - Intronic
1138712683 16:58986864-58986886 TGTACATCTTCAGAGATCTGGGG + Intergenic
1139553048 16:67686718-67686740 CCCAGCTCTTCAGGAAGCTGAGG + Intronic
1140531996 16:75674823-75674845 CCCAGCTATTCAGGAATCTGAGG - Intronic
1141187564 16:81798787-81798809 TCCACCTCTTCTGAGCTCTGCGG - Intronic
1141207802 16:81946935-81946957 CCCAGATCTTCAGTGAGCTGGGG - Intronic
1141216047 16:82024755-82024777 CCCACCCCCACAAAGATCTGTGG - Intergenic
1203126244 16_KI270728v1_random:1586197-1586219 CCCTCTTCTGCAGGGATCTGTGG + Intergenic
1143866070 17:9925151-9925173 ACCTCCTGGTCAGAGATCTGGGG + Intronic
1143974020 17:10816759-10816781 CCCACCCCTTCTAAGAGCTGAGG - Intergenic
1144521419 17:15954833-15954855 GCAACCCCTTCAGACATCTGAGG - Intronic
1144797766 17:17904081-17904103 CCCACCTATTCAGAAGGCTGAGG - Intronic
1145982072 17:29018804-29018826 CCCACCCCTTCCCAGATCTATGG - Intronic
1146841089 17:36154780-36154802 CCCACCTTTTCCTAGCTCTGTGG + Intergenic
1147190234 17:38734148-38734170 CCCACCCCTTGAGAGGTCAGCGG - Exonic
1147980979 17:44273775-44273797 CCCAACTCCTCAGAGGGCTGAGG + Intergenic
1148824189 17:50380207-50380229 CCCACCTCTTCCAAGGTCAGTGG + Intronic
1148905570 17:50909782-50909804 CCGACCCCTTCAGAGCTCTCTGG + Intergenic
1149604054 17:57912433-57912455 CCCATTTCTTCAAACATCTGGGG + Intronic
1149693321 17:58596824-58596846 CCCACCTACTCAGGGGTCTGAGG + Intronic
1152313406 17:79564923-79564945 CCCAGCTATTCAGGGAGCTGAGG + Intergenic
1152770649 17:82166397-82166419 CCCAGCTCTTCAGCAGTCTGAGG + Intronic
1153590599 18:6670551-6670573 CCCAGCTATTCAGAGGGCTGAGG - Intergenic
1154387312 18:13905938-13905960 CCCAGCTACTCAGAGAGCTGAGG + Intronic
1154962675 18:21325696-21325718 CCCAGCTACTCAGAGAGCTGAGG + Intronic
1157194984 18:45613664-45613686 GCCACCTCCCTAGAGATCTGTGG + Intronic
1158339581 18:56450877-56450899 CCCACCTTTTCTGGGATCTGGGG - Intergenic
1159255315 18:65937541-65937563 CCCTCTTCTTCAGAAAACTGTGG - Intergenic
1159356849 18:67346919-67346941 TCCTCCTCTTCAGGGATCTCAGG - Intergenic
1159710309 18:71749923-71749945 CCCACCTCTTCAGAAGGCTAAGG + Intronic
1160079773 18:75714361-75714383 CCCACTTCTTCATAATTCTGTGG + Intergenic
1160206461 18:76837554-76837576 CCCAGCTACTCAGAAATCTGAGG - Intronic
1160425519 18:78776341-78776363 CCCACCTCTTCAGAGGAGAGGGG + Intergenic
1160695684 19:483269-483291 CCCACCTCCTCAGGGATCCCTGG + Intergenic
1160799494 19:961152-961174 CCCACCCCTTCCGACCTCTGTGG - Intronic
1165161845 19:33820940-33820962 CCCACCTCCCCAGACGTCTGGGG + Intergenic
1165867202 19:38946147-38946169 CCCACCCCTTCAGAGACCCTGGG + Intronic
1165956138 19:39503198-39503220 CACCCCTCTTCAGGGAGCTGGGG + Intronic
1166039810 19:40195007-40195029 CCCAGCTTTACAAAGATCTGGGG + Intronic
1166101186 19:40572302-40572324 CACAGGACTTCAGAGATCTGGGG - Intronic
1166106162 19:40599135-40599157 CCCTCCTTTGCAGAGTTCTGGGG + Intronic
1166210214 19:41302119-41302141 GCCACCTCTTCAGAAAACGGAGG + Intronic
1167347688 19:48956372-48956394 CCCAGGTCCTCACAGATCTGAGG - Intronic
1167724255 19:51200035-51200057 CCACCCCCTTCAGAGAGCTGAGG - Intergenic
1168319810 19:55502016-55502038 CCCACCTTTTCAGGAAGCTGAGG - Intronic
1168667189 19:58212992-58213014 CCCACCTCATCAGACATCAGAGG + Exonic
925717053 2:6794004-6794026 CTCACGTCTTCTGAGATCTATGG - Intergenic
925919292 2:8628124-8628146 GCCACTTCCACAGAGATCTGAGG - Intergenic
926287941 2:11505489-11505511 CCCACATCCTCAGGGATGTGAGG + Intergenic
927651576 2:24916769-24916791 GCCCCCTCTACAGAGATTTGGGG + Intronic
929094069 2:38247320-38247342 CCCACCTCCACAGCCATCTGTGG - Intergenic
929367407 2:41176668-41176690 CCCACATCTGTAGAGCTCTGGGG - Intergenic
930581054 2:53212458-53212480 ACCTCTTCTGCAGAGATCTGTGG - Intergenic
932953664 2:76325068-76325090 CACATTTCTTCAGATATCTGAGG - Intergenic
934633270 2:95954880-95954902 CCCTCTTCTGCAGGGATCTGTGG + Intronic
934800230 2:97148399-97148421 CCCTCTTCTGCAGGGATCTGTGG - Intronic
935297613 2:101664355-101664377 CCCAGCTCTTCAGAAGGCTGAGG + Intergenic
937134419 2:119540603-119540625 CCCACCTCTTCATGGAGCAGTGG + Intergenic
937909853 2:127070177-127070199 CCCATCTCTTCACAGCTCAGTGG + Intronic
938405399 2:131030104-131030126 CCCACCTCTCCGGAGTCCTGAGG - Intronic
938813621 2:134877416-134877438 CTCACCTCTTGAGAGATTTTGGG - Intronic
940123138 2:150291136-150291158 CCCAGCTCTTCAGGAAGCTGAGG + Intergenic
940463973 2:154004711-154004733 CCTACCACTTCAAAGATCAGAGG - Intronic
940829112 2:158448461-158448483 CCCAGCTCCTCAGGGGTCTGAGG - Intronic
940904141 2:159153644-159153666 CCTGCCTCTTCAAAGACCTGTGG - Intronic
946426169 2:219598207-219598229 CCCACCTCGTCCGAGGTCCGAGG - Intronic
947565179 2:231189067-231189089 CCCACCCCTTGAGAGCTCTGAGG - Intergenic
947965927 2:234281566-234281588 CCCTACTCTTCAGAGCTCTTGGG + Intergenic
948383252 2:237565283-237565305 CCCACCTCAGCACAGATCAGAGG + Intergenic
1169607406 20:7338112-7338134 CTCCCCTCTTCAGAGATTGGAGG - Intergenic
1170472432 20:16681614-16681636 AGCACCTCTTAAGAGATCTCTGG - Intergenic
1171290208 20:23978862-23978884 CCAGACTCTTCAGAGATCTGTGG + Intergenic
1174450668 20:50618149-50618171 CCCAGCTCCTCAGAAGTCTGAGG + Intronic
1175877549 20:62237542-62237564 CCCAGCTCTGGAGAGGTCTGTGG + Intronic
1177922068 21:27164534-27164556 CCCACCTCATCACAAATATGGGG - Intergenic
1178558081 21:33611348-33611370 GACACTTTTTCAGAGATCTGAGG - Intronic
1179442163 21:41402893-41402915 CCCACCTCTTTTCAGATCTGCGG - Intronic
1180767219 22:18352151-18352173 CCAGACTCTTCAGAGATCTGTGG - Intergenic
1180779090 22:18510228-18510250 CCAGACTCTTCAGAGATCTGTGG + Intergenic
1180811811 22:18767548-18767570 CCAGACTCTTCAGAGATCTGTGG + Intergenic
1181197965 22:21201790-21201812 CCAGACTCTTCAGAGATCTGTGG + Intergenic
1181401780 22:22654015-22654037 CCAGACTCTTCAGAGATCTGTGG - Intergenic
1181703735 22:24635108-24635130 CCAGACTCTTCAGAGATCTGTGG - Intergenic
1181986869 22:26805950-26805972 TCCAACTCTTCTGAGCTCTGTGG + Intergenic
1182339388 22:29607062-29607084 TCCACCACCTCAGAGGTCTGTGG - Intronic
1182521635 22:30887975-30887997 CCCACATGTTGAGAGATCGGGGG + Intronic
1182549839 22:31094795-31094817 CCCACCTACTCAGAAAGCTGAGG - Intronic
1182835704 22:33339782-33339804 CCCAGCTATTCAGAGGGCTGAGG - Intronic
1183510987 22:38234836-38234858 CCCACCTCTTAGGAGCTGTGTGG + Intronic
1183688853 22:39377002-39377024 CACCCTTCTGCAGAGATCTGGGG + Intronic
1183847324 22:40553077-40553099 CCCTACTCTAGAGAGATCTGTGG + Intronic
1184385258 22:44170594-44170616 CCCAGCTCTGCAGAGAACTGGGG + Intronic
1184552182 22:45210353-45210375 CTCACCTCTGCACAGTTCTGGGG - Intronic
1184599533 22:45534607-45534629 CACACCCCTTCTGACATCTGAGG + Intronic
1184970867 22:48019010-48019032 CCCAGCCCAACAGAGATCTGTGG - Intergenic
1185281054 22:49970076-49970098 GGCAGCTCTGCAGAGATCTGGGG + Intergenic
1203228841 22_KI270731v1_random:93045-93067 CCAGACTCTTCAGAGATCTGTGG - Intergenic
950896486 3:16456317-16456339 ACCCCATCTTCGGAGATCTGTGG + Intronic
951934894 3:28011773-28011795 CCCAGCTACTCAGAGGTCTGAGG - Intergenic
952465961 3:33586248-33586270 CCCACCTACTCAGGAATCTGAGG - Intronic
953410478 3:42688045-42688067 CCGACCTCCTCCGTGATCTGGGG + Intronic
954291738 3:49653532-49653554 CCCACCTCCTCAGACAGCAGCGG + Exonic
957613385 3:82497989-82498011 CCTACCTGTTCAGACGTCTGTGG - Intergenic
957959904 3:87236154-87236176 CCCACCTCTCCTGACATATGGGG + Intronic
958931401 3:100211822-100211844 TCCAGCCCTTCAGAGATCTTTGG - Intergenic
960462560 3:117954267-117954289 ACTAACTATTCAGAGATCTGGGG - Intergenic
961126118 3:124419525-124419547 CGAGCCTCTTCAGAGAACTGAGG - Intronic
961603459 3:128077254-128077276 CCCACCCCTTCACAGTTCCGGGG + Intronic
963031851 3:140986444-140986466 ACCAGATCATCAGAGATCTGGGG + Intergenic
963226192 3:142864249-142864271 GCCATCTCTTCAGACAGCTGAGG - Intronic
964111805 3:153095799-153095821 CTCTCCTCTCCAGAGATCTGGGG + Intergenic
964181918 3:153898391-153898413 CATACCTCTTAAGAGATCTCTGG + Intergenic
964729627 3:159851173-159851195 CCCAGCTATTCAGAAAGCTGAGG + Intronic
966017200 3:175155166-175155188 CCCACCGCCCCAGAGACCTGAGG - Intronic
966849551 3:184156059-184156081 CTTACCTCTTCAGAGACCAGTGG + Intronic
966878644 3:184337463-184337485 CCCACCTCCTCAGAGCCATGAGG + Exonic
968561312 4:1284524-1284546 ACCACCTCCTAAGAGATGTGTGG + Intergenic
970090128 4:12397200-12397222 CCCAGCTATTCAGAGGGCTGAGG - Intergenic
972561852 4:40235864-40235886 CCCAGCTCTTCAGGAATGTGAGG + Intronic
972656443 4:41067974-41067996 CCCACCTCTTTTGAGATCTCAGG - Intronic
973337496 4:48971425-48971447 CCCAGCTATTCAGAAAGCTGAGG - Intergenic
973589279 4:52424503-52424525 CCCACTCTTACAGAGATCTGAGG + Intergenic
973718224 4:53699019-53699041 CCCAGCTCTTCAGGAAGCTGAGG - Intronic
975815885 4:78216590-78216612 CCCACAACTGCAGATATCTGTGG - Intronic
976563912 4:86531936-86531958 CCCAGCTATTCAGGGAGCTGAGG + Intronic
978046958 4:104141833-104141855 CCCAACTATTCAGGGAGCTGAGG - Intergenic
979444337 4:120793175-120793197 CCCACCTCCTGTGAGATCAGTGG + Intronic
983417499 4:167477247-167477269 GCCACCTACTCAGAGATGTGAGG - Intergenic
985002144 4:185496281-185496303 CCCACCTCTTCTTACATCTATGG - Intergenic
987798890 5:22667309-22667331 ACCATCTCTGCTGAGATCTGAGG - Intronic
988524249 5:31972730-31972752 CTCACCTCATCAGGGAACTGAGG - Intronic
988967995 5:36439306-36439328 CCCACCTCATCAAGGATATGAGG + Intergenic
990050637 5:51495069-51495091 ACCTCCTCTTCCGAGTTCTGTGG - Intergenic
990890456 5:60643470-60643492 CCCATCTCATCAGATGTCTGTGG - Intronic
991071380 5:62485732-62485754 CCCAACTCTTCAGGAATCTGAGG + Intronic
992414792 5:76542097-76542119 CCCACCTACTCAGAGGGCTGAGG - Intronic
993189008 5:84657082-84657104 TCCACCTCCTGAAAGATCTGTGG - Intergenic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
998336611 5:141377353-141377375 CCCACCTCTTCAGGAGGCTGAGG + Intronic
1001822703 5:174722253-174722275 TCCACCTCAGCAGAGAGCTGGGG + Intergenic
1002159252 5:177305320-177305342 TCCACCTCTTCAGAAGGCTGAGG - Intronic
1002386881 5:178875121-178875143 CCCACATTTTCAGAGCACTGAGG - Intronic
1006103074 6:31698769-31698791 CCCAGCCCTGCAGAGATCAGGGG + Intronic
1006701894 6:35981534-35981556 CCCAACTACTCAGAGAGCTGAGG + Intronic
1007078373 6:39082195-39082217 CCCTCCCATTTAGAGATCTGAGG - Intronic
1007430716 6:41775206-41775228 GCCACTTCTTCAGAGAGCTGTGG + Intronic
1007664970 6:43508661-43508683 CCCACATCATCAGAGCTCTGGGG + Intronic
1007797031 6:44357496-44357518 CCCAGCTATTCAGGGAGCTGAGG - Intronic
1009377998 6:62995087-62995109 GCCCCCACTTTAGAGATCTGTGG - Intergenic
1009426004 6:63514341-63514363 CCCAGCTGTTCAGGGATCTGAGG - Intergenic
1014265972 6:119278031-119278053 CCCAGCTATTCAGAGAGCTGAGG + Intronic
1014885641 6:126777620-126777642 CTCACCACTTCATACATCTGTGG - Intergenic
1015306433 6:131713892-131713914 CCCAGCTCTTCAGGAAGCTGAGG - Intronic
1015550602 6:134408688-134408710 CCAAACTATTGAGAGATCTGAGG + Intergenic
1015933562 6:138386035-138386057 CCCAGCTCCTCAGGGACCTGAGG - Intergenic
1019266736 7:121444-121466 CCCTTAGCTTCAGAGATCTGAGG - Intergenic
1019962776 7:4474736-4474758 CCCACCTGCTCAGAAAGCTGAGG - Intergenic
1020073104 7:5240381-5240403 CCCAACTGTGCAGACATCTGCGG + Intergenic
1022717812 7:32914620-32914642 CCCACCTCTGCTGACATCTTCGG - Intergenic
1023257746 7:38328917-38328939 CCCTGCTCTACAGAAATCTGGGG - Intergenic
1023365096 7:39456177-39456199 TCCACCTTGTGAGAGATCTGAGG + Intronic
1023699500 7:42878411-42878433 ACTTCCTCTTCAGAGCTCTGTGG + Intergenic
1025728871 7:64092337-64092359 CCCACCTATTCAGGAAGCTGAGG + Intronic
1025959506 7:66207411-66207433 CCCTCTTCTTCTGAGATCAGAGG - Intronic
1026961247 7:74409149-74409171 CCCAGCTGTTCAGGGAGCTGAGG + Intergenic
1027251338 7:76400584-76400606 CCACCCTCTTCACAGAGCTGAGG - Exonic
1027811458 7:82905577-82905599 CCCACTTCCCCAGAAATCTGGGG - Intronic
1028208962 7:88050275-88050297 CCCAGCTCCTCAGAAAACTGAGG + Intronic
1028965274 7:96795201-96795223 CCCACTTCTTCCTTGATCTGAGG - Intergenic
1029535961 7:101157899-101157921 CCCACCTCCTCAGGGGACTGAGG - Intronic
1029688502 7:102165099-102165121 GCCACCTCTCCACAGGTCTGGGG + Intronic
1031914501 7:127550192-127550214 CCCACATCCTCACAGATCTGAGG + Intergenic
1032011491 7:128350847-128350869 GCCACCTCTTCACAGGTCTATGG + Exonic
1032196317 7:129790863-129790885 TCCCACCCTTCAGAGATCTGAGG - Intergenic
1033149551 7:138901439-138901461 CCCACCTCTTCAGGAGGCTGAGG - Intronic
1033731116 7:144180608-144180630 CCCAGCTCTTCAGGAAGCTGAGG + Intergenic
1033740546 7:144272124-144272146 CCCAGCTCTTCAGGAAGCTGAGG - Intergenic
1034745984 7:153524302-153524324 CCCACCTCTGCAGAGACCAGGGG + Intergenic
1035198407 7:157242357-157242379 GCCACCTCTTGAGAAATTTGAGG - Intronic
1035598696 8:882225-882247 AGCACATCATCAGAGATCTGCGG + Intergenic
1037540711 8:19867841-19867863 CCCAGCTACTCAGAGAGCTGAGG - Intergenic
1039296877 8:36165925-36165947 CCCAGCTATTCAGGGGTCTGAGG + Intergenic
1039468078 8:37797628-37797650 CCCCCCACTTCAGAGATTTCTGG + Intronic
1041321586 8:56619401-56619423 CCCACCACCTCAGATATCAGTGG + Intergenic
1041426447 8:57726123-57726145 CACTCCTCTTCAGAGTTCTTGGG - Intergenic
1042041034 8:64588858-64588880 CCCAACTCTTCACATTTCTGTGG - Intronic
1044334231 8:90959477-90959499 CCCACCGGTTCAAAGATCTTTGG - Intronic
1044477663 8:92647196-92647218 CTCACCTCTTGAGAGATCAGTGG + Intergenic
1045181117 8:99783830-99783852 CCTCCCTCTTAAGGGATCTGGGG + Intronic
1045524571 8:102930669-102930691 CCCACCTATTCAGAAGGCTGAGG - Intronic
1045734004 8:105274262-105274284 CCCACCTCTTCAGAGATCTGAGG - Intronic
1047094628 8:121610729-121610751 CCCTGCTCTTTAGAAATCTGTGG - Intergenic
1049106886 8:140619566-140619588 CCCTCCTCTTCTGTGCTCTGCGG - Intronic
1049202195 8:141345844-141345866 CCGACCTCTCCAGGAATCTGGGG + Intergenic
1050231038 9:3526128-3526150 CGCACCTCTTCGGAGTCCTGCGG - Intergenic
1050658504 9:7856394-7856416 CCCAGCTACTCAGAGAGCTGAGG + Intronic
1053240570 9:36491358-36491380 CCCAGCTCCTCAGGAATCTGAGG + Intergenic
1060396708 9:123321407-123321429 CCCTCCTCTGCAGAGTTCTGAGG + Intergenic
1060992677 9:127857786-127857808 CCCACCCCTGCAGAGGTCAGAGG + Intergenic
1203776381 EBV:75457-75479 CCCACCTAAAGAGAGATCTGGGG + Intergenic
1185569241 X:1120628-1120650 CCCAGCTATTCAGAAAGCTGAGG - Intergenic
1188095171 X:26012372-26012394 CCCAGGTCTTCAGAGTACTGTGG + Intergenic
1188229538 X:27644612-27644634 GCCTCCTCTTCATAGATCTATGG - Intronic
1188702137 X:33277987-33278009 CCCAGCTATTCAGAAAGCTGAGG + Intronic
1189130485 X:38493092-38493114 GCCAGCTCTTCTGAGATATGAGG - Intronic
1192363711 X:70454705-70454727 CCGACCTCTTAAGAGATCTTGGG + Intronic
1193109318 X:77711717-77711739 CCCAGCTATTCAGAAAGCTGAGG + Intronic
1194905875 X:99575931-99575953 GCCACTGCTTTAGAGATCTGTGG + Intergenic
1195600838 X:106745920-106745942 CCAAACTCTTCAGACAACTGGGG - Intronic
1198532654 X:137561169-137561191 CCCATCTCTTCAGGTGTCTGGGG + Intergenic
1198956187 X:142134437-142134459 ACCACTTCCTTAGAGATCTGTGG + Intergenic
1199460047 X:148074523-148074545 CCAACCTCTAGAGAGACCTGGGG - Intergenic