ID: 1045735733

View in Genome Browser
Species Human (GRCh38)
Location 8:105294703-105294725
Sequence CTGTTCCAGTGTATCATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 549}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045735733_1045735739 17 Left 1045735733 8:105294703-105294725 CCAAAAATGATACACTGGAACAG 0: 1
1: 0
2: 3
3: 21
4: 549
Right 1045735739 8:105294743-105294765 TTGGGAGATGGTGCTCTGGTTGG No data
1045735733_1045735736 -1 Left 1045735733 8:105294703-105294725 CCAAAAATGATACACTGGAACAG 0: 1
1: 0
2: 3
3: 21
4: 549
Right 1045735736 8:105294725-105294747 GGTATTACTCAGAGTAATTTGGG No data
1045735733_1045735737 5 Left 1045735733 8:105294703-105294725 CCAAAAATGATACACTGGAACAG 0: 1
1: 0
2: 3
3: 21
4: 549
Right 1045735737 8:105294731-105294753 ACTCAGAGTAATTTGGGAGATGG No data
1045735733_1045735738 13 Left 1045735733 8:105294703-105294725 CCAAAAATGATACACTGGAACAG 0: 1
1: 0
2: 3
3: 21
4: 549
Right 1045735738 8:105294739-105294761 TAATTTGGGAGATGGTGCTCTGG No data
1045735733_1045735735 -2 Left 1045735733 8:105294703-105294725 CCAAAAATGATACACTGGAACAG 0: 1
1: 0
2: 3
3: 21
4: 549
Right 1045735735 8:105294724-105294746 AGGTATTACTCAGAGTAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045735733 Original CRISPR CTGTTCCAGTGTATCATTTT TGG (reversed) Intronic
900766309 1:4508192-4508214 TTAATCCAGTGTATCATTGTTGG - Intergenic
901223604 1:7598319-7598341 TTAATCCAGTCTATCATTTTTGG + Intronic
903808963 1:26024001-26024023 CTGCTCCCGTGTCTAATTTTGGG + Intronic
905455897 1:38087707-38087729 CTGTTCAATTGTATCATTTGAGG + Intergenic
906356289 1:45108311-45108333 CTGTTCCATTATATCAATGTTGG + Intronic
907572301 1:55494447-55494469 TTAATCCAGTCTATCATTTTTGG + Intergenic
908165169 1:61450422-61450444 CTACTCCAGTGGGTCATTTTTGG - Intronic
908478615 1:64513981-64514003 CTGTTCCAGATAATCTTTTTAGG + Intronic
909436118 1:75645010-75645032 TTAATCCAGTGTATCATTGTTGG + Intergenic
909751835 1:79170670-79170692 TTAATCCAGTCTATCATTTTTGG - Intergenic
910111167 1:83684898-83684920 TTAATCCAGTCTATCATTTTTGG + Intergenic
911416691 1:97583797-97583819 TTATTCCAGTCTATCATTGTTGG + Intronic
912037821 1:105344060-105344082 TTAATCCAGTCTATCATTTTTGG - Intergenic
912219623 1:107658332-107658354 TTGATCCAGTCTATCATTGTTGG + Intronic
912315262 1:108661992-108662014 CAGTTCCAATATATCATTTGTGG - Intergenic
912879531 1:113395715-113395737 ATTTTCTAGTATATCATTTTGGG + Intronic
913055328 1:115153437-115153459 TTGATCCAGTCTATCATTGTTGG - Intergenic
913256549 1:116959437-116959459 CTGGTCCACTGAATCATTCTTGG + Intronic
915645601 1:157269843-157269865 CTTTCTCAGTGTATCACTTTGGG + Intergenic
915677943 1:157549042-157549064 TTGATCCAGTCTATCATTGTTGG - Intronic
916990356 1:170236859-170236881 CTTATCCAGTCTATCATTGTTGG - Intergenic
917606343 1:176634200-176634222 TTAATCCAGTCTATCATTTTTGG - Intronic
918637288 1:186793010-186793032 TTGTGCTAGTGTATCATTATAGG + Intergenic
918737539 1:188085434-188085456 CCTCTCCAGTGGATCATTTTTGG + Intergenic
918945860 1:191064142-191064164 TTAATCCAGTCTATCATTTTTGG - Intergenic
919072629 1:192775040-192775062 CTGTCCCAGTGCATTACTTTAGG - Intergenic
919150836 1:193696372-193696394 CTGTTGCAGTGTTTCAACTTTGG + Intergenic
919219391 1:194606922-194606944 TTATTCCAGTCTATCATTGTTGG + Intergenic
919471825 1:197988591-197988613 TTGATCCAGTCTATCATTGTTGG + Intergenic
920814967 1:209322787-209322809 TTAATCCAGTCTATCATTTTTGG - Intergenic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
920953371 1:210595349-210595371 CTAATCCAGTCTATCATTGTTGG + Intronic
921705696 1:218320444-218320466 TTGATCCAGTCTATCATTGTTGG + Intronic
922609622 1:226915735-226915757 CTGTTCCAGTTCATCTGTTTAGG + Intronic
923216141 1:231849643-231849665 CTTTCCAAGTGTATGATTTTAGG + Intronic
923834237 1:237592247-237592269 CTTTTTCAATGTAGCATTTTAGG - Intronic
1063489823 10:6453677-6453699 TTAATCCAGTCTATCATTTTTGG - Intronic
1063831932 10:9963333-9963355 TTAATCCAGTCTATCATTTTTGG - Intergenic
1064077818 10:12284006-12284028 TTATTCCAGTCTATCATTGTTGG + Intergenic
1064545222 10:16443421-16443443 CTATTGCAGTGGAGCATTTTGGG - Intronic
1066507635 10:36062037-36062059 TTAATCCAGTCTATCATTTTTGG + Intergenic
1066677438 10:37902590-37902612 TTGATCCAGTCTATCATTGTTGG - Intergenic
1066761010 10:38753348-38753370 TTAATCCAGTCTATCATTTTTGG + Intergenic
1066816950 10:39430603-39430625 TTAATCCAGTGTATCATTTTTGG - Intergenic
1066960575 10:42219075-42219097 TTAATCCAGTCTATCATTTTTGG - Intergenic
1067903861 10:50270607-50270629 TTAATCCAGTCTATCATTTTTGG - Intergenic
1068373086 10:56144620-56144642 CTAATCCAGTCTATCATTGTTGG - Intergenic
1071126718 10:82344447-82344469 TTAATCCAGTGTATCATTGTTGG + Intronic
1071277709 10:84070967-84070989 TTGATCCAGTCTATCATTGTTGG + Intergenic
1071304421 10:84285604-84285626 TTGATCCAGTCTATCATTGTTGG - Intergenic
1071422745 10:85517299-85517321 TTGATCCAGTCTATCATTGTTGG + Intergenic
1073540950 10:104315839-104315861 CTGCTCCAGTGCCTCCTTTTCGG + Exonic
1073659816 10:105462527-105462549 CTTTTCCAGTCTATCATTGATGG - Intergenic
1073739401 10:106389556-106389578 ATGTTTCAGTGTATGATTTGGGG - Intergenic
1073810511 10:107147537-107147559 CTCTTCCTGTGTCTCATTTTTGG + Intronic
1074205427 10:111278870-111278892 TTAATCCAGTCTATCATTTTTGG - Intergenic
1075268701 10:121029455-121029477 TTGATCCAGTCTATCATTGTTGG + Intergenic
1078425261 11:11244579-11244601 CTGTTCCAGTGACTGGTTTTGGG + Intergenic
1078523331 11:12081179-12081201 TTAATCCAGTCTATCATTTTTGG + Intergenic
1078695119 11:13623405-13623427 TTAATCCAGTCTATCATTTTTGG + Intergenic
1078821221 11:14884288-14884310 TTCATCCAGTCTATCATTTTTGG - Intronic
1078951428 11:16138934-16138956 TTAATCCAGTCTATCATTTTTGG + Intronic
1079174139 11:18122570-18122592 TTCATCCAGTCTATCATTTTTGG + Intronic
1079625250 11:22609338-22609360 TTAATCCAGTCTATCATTTTTGG - Intergenic
1079649710 11:22911321-22911343 CTAATCCAGTCTATCATTGTTGG - Intergenic
1080574920 11:33589519-33589541 TTATTCCAGTCTATCATTGTTGG - Intronic
1081165013 11:39797853-39797875 TTATTCCAGTCTATCATTGTTGG + Intergenic
1081735486 11:45400646-45400668 CTGTGCCAGTGTCTTATTTTAGG + Intergenic
1082589703 11:54990752-54990774 CTCATCCAATGTATCATTGTTGG - Intergenic
1082630327 11:55534396-55534418 CTAATCCAGTCTATCATTGTTGG - Intergenic
1083139103 11:60706979-60707001 CTGTACCAGTTTATCATTTCAGG + Exonic
1083517256 11:63271706-63271728 TTAATCCAGTCTATCATTTTTGG + Intronic
1084274959 11:68046617-68046639 CGACTCCAGTGTATCTTTTTTGG + Intronic
1085248517 11:75125065-75125087 TTAATCCAGTCTATCATTTTTGG - Intronic
1086163175 11:83746334-83746356 CTAATCCAGTCTATCATTGTTGG - Intronic
1086389558 11:86348707-86348729 ATGTTTCAGTGTTTCATTTCAGG - Intergenic
1086977560 11:93153254-93153276 CTGGTCCCTGGTATCATTTTAGG + Intronic
1087055011 11:93926262-93926284 TTAATCCAGTGTATCATTGTTGG - Intergenic
1087528409 11:99348340-99348362 CTGTTCTAGTGTATTTTTTTGGG - Intronic
1087624189 11:100577865-100577887 CTGTTGCAGAGTATCAGTGTGGG + Intergenic
1088147564 11:106700582-106700604 CCGCTCCAGTTTATCCTTTTGGG + Intronic
1088179163 11:107089547-107089569 TTAATCCAGTCTATCATTTTTGG - Intergenic
1088303016 11:108379234-108379256 TTAATCCAGTCTATCATTTTTGG - Intronic
1088875022 11:113928269-113928291 TTTATCCAGTGTATCATTGTTGG + Intronic
1088958302 11:114633848-114633870 TTAATCCAGTCTATCATTTTTGG + Intergenic
1091179488 11:133590846-133590868 TTAATCCAGTCTATCATTTTTGG - Intergenic
1091619883 12:2078886-2078908 TTATTCCAGTCTATCATTATTGG - Intronic
1093345001 12:18029522-18029544 TTAATCCAGTCTATCATTTTTGG - Intergenic
1093979958 12:25465204-25465226 TTAATCCAGTGTATCATTGTTGG + Intronic
1094246587 12:28303440-28303462 ATGTTCAAGTGTATCATGTTAGG - Intronic
1094261360 12:28503692-28503714 TTATTCCAGTCTATCATTGTTGG - Intronic
1094522709 12:31209786-31209808 TTAATCCAGTCTATCATTTTTGG + Intergenic
1094739291 12:33270226-33270248 TTAATCCAGTCTATCATTTTTGG + Intergenic
1094862359 12:34482052-34482074 TTGATCCAGTCTATCATTGTTGG - Intergenic
1095127651 12:38501041-38501063 CTTTTCCAGTCTATCATTGATGG - Intergenic
1095224538 12:39664459-39664481 TTGATCCAGTCTATCATTGTTGG + Intronic
1095388535 12:41678069-41678091 TTGATCCAGTCTATCATTGTTGG - Intergenic
1095561028 12:43565163-43565185 GTAATCCAGTTTATCATTTTTGG - Intergenic
1096890906 12:54770227-54770249 TTAATCCAGTCTATCATTTTTGG + Intergenic
1097304491 12:58054054-58054076 TTAATCCAGTCTATCATTTTTGG + Intergenic
1099171334 12:79368281-79368303 TTAATCCAGTCTATCATTTTTGG + Intronic
1099515793 12:83595302-83595324 TTAATCCAGTCTATCATTTTTGG - Intergenic
1099729039 12:86474128-86474150 TTAATCCAGTCTATCATTTTTGG - Intronic
1099730980 12:86501728-86501750 TTTTTCCAGTGTATCATTGATGG + Intronic
1100201988 12:92308687-92308709 CTGTTCTATTTTATTATTTTTGG - Intergenic
1102750645 12:115290746-115290768 TTATTCCAGTCTATCATTGTTGG - Intergenic
1103695313 12:122810777-122810799 TTAATCCAGTCTATCATTTTTGG - Intronic
1104571601 12:129930640-129930662 TTGATCCAGTCTATCATTGTTGG + Intergenic
1105232380 13:18509215-18509237 TTAATCCAGTGTATCATTGTTGG - Intergenic
1106175438 13:27326859-27326881 CTTTTCCAGTCTATCATTGATGG - Intergenic
1106862522 13:33925965-33925987 CTAATCCAGTCTATCATTGTTGG - Intronic
1107118490 13:36773030-36773052 CTGTTCCATTGTTTCATTCCTGG + Intergenic
1107652314 13:42557698-42557720 TTAATCCAGTGTATCATTGTTGG - Intergenic
1108864573 13:54907050-54907072 ATTTTCCAGTGTATCCTTTTAGG - Intergenic
1109235484 13:59812978-59813000 TTGCTCCAGTTTATCATTCTGGG - Intronic
1109981701 13:69916347-69916369 TTGATCCAGTCTATCATTGTTGG - Intronic
1110153744 13:72287545-72287567 TTAATCCAGTCTATCATTTTTGG - Intergenic
1110878412 13:80539599-80539621 TTAATCCAGTCTATCATTTTTGG + Intergenic
1111040646 13:82742538-82742560 TTGATCCAGTCTATCATTGTTGG - Intergenic
1111087860 13:83400403-83400425 CTTATCCAGTCTATCATTTTTGG + Intergenic
1112069329 13:95830885-95830907 TTAATCCAGTCTATCATTTTTGG - Intronic
1112801680 13:103118177-103118199 TTAATCCAGTGTATCATTGTTGG + Intergenic
1112803539 13:103137792-103137814 TTGATCCAGTCTATCATTGTTGG - Intergenic
1113024445 13:105924824-105924846 TTTTCCCAGTGTATTATTTTAGG - Intergenic
1113170773 13:107500711-107500733 TTAATCCAGTGTATCATTGTTGG - Intronic
1113824821 13:113243812-113243834 TTGTTCCTCTGTATCATTTGTGG + Intronic
1114154283 14:20082757-20082779 CTAATCCAGTCTATCATTGTTGG + Intergenic
1114361535 14:21978919-21978941 CTGTTTCAGTGTATCTCTTCTGG + Intergenic
1116137633 14:40949296-40949318 CTAATCCAGTCTATCATTGTTGG + Intergenic
1116170551 14:41396245-41396267 TTAATCCAGTCTATCATTTTTGG - Intergenic
1116200996 14:41795533-41795555 TTAATCCAGTCTATCATTTTTGG - Intronic
1116230140 14:42205288-42205310 TTAATCCAGTCTATCATTTTTGG + Intergenic
1116242713 14:42366713-42366735 TTATTCCAGTCTATCATTGTTGG + Intergenic
1116367354 14:44083951-44083973 CTAATCCAGTCTATCATTGTTGG - Intergenic
1116373007 14:44159874-44159896 TTGATCCAGTCTATCATTGTTGG - Intergenic
1116385492 14:44324777-44324799 TTAATCCAGTCTATCATTTTTGG - Intergenic
1116787603 14:49304644-49304666 CTTTTCCAGTGTCACATTCTGGG - Intergenic
1117725979 14:58674274-58674296 CTTTTCCAGTATATCATATCAGG + Intergenic
1118309859 14:64684128-64684150 CTCTTCCAGTTTCTCATGTTTGG + Intergenic
1119565575 14:75626345-75626367 TTGTGCCAGAGTTTCATTTTAGG + Intronic
1120737912 14:88076124-88076146 CTGTGCCAGTGTATCAGTTTGGG + Intergenic
1121078193 14:91086512-91086534 TTGTTACACTGTATCATTTAGGG + Intronic
1121712384 14:96048407-96048429 CTTTTCCAGGGTATCATAGTTGG + Intronic
1121818862 14:96949741-96949763 CTGGTCCACTGTGTGATTTTGGG + Intergenic
1123167285 14:106338037-106338059 TTAATCCAGTGTATCATTGTTGG - Intergenic
1123169905 14:106362748-106362770 TTAATCCAGTGTATCATTGTTGG - Intergenic
1123174884 14:106407479-106407501 CTAATCCAGTCTATCATTGTTGG - Intergenic
1123221727 14:106863715-106863737 TTAATCCAGTCTATCATTTTTGG + Intergenic
1202931729 14_KI270725v1_random:43634-43656 TTAATCCAGTCTATCATTTTTGG + Intergenic
1123386654 15:19817357-19817379 CTAATCCAGTCTATCATTGTTGG + Intergenic
1124099545 15:26680519-26680541 GTGTTCCCATGTGTCATTTTTGG - Intronic
1125231865 15:37465520-37465542 TTAATCCAGTCTATCATTTTTGG + Intergenic
1125788761 15:42346387-42346409 CTGGTCCAGGGTTTCTTTTTGGG + Intronic
1126186060 15:45831381-45831403 CTTTTCCAGTTTTACATTTTGGG + Intergenic
1126502359 15:49359846-49359868 TTAATCCAGTCTATCATTTTTGG - Intronic
1126678053 15:51178605-51178627 TTGATCCAGTCTATCATTGTTGG - Intergenic
1127284204 15:57518371-57518393 CTGACCCAGTGTTTCATTGTAGG + Exonic
1127527596 15:59809094-59809116 TTGATCCAGTCTATCATTGTTGG - Intergenic
1130513782 15:84610155-84610177 CTGTTCCAGTGAATGATTTTTGG + Intronic
1130729842 15:86479842-86479864 TTAATCCAGTCTATCATTTTTGG - Intronic
1131706908 15:95006559-95006581 TTAATCCAGTCTATCATTTTTGG + Intergenic
1132192864 15:99883850-99883872 TTGATCCAGTCTATCATTGTTGG - Intergenic
1133157548 16:3885781-3885803 TTAATCCAGTGTATCATTGTTGG + Intergenic
1134778655 16:16875405-16875427 CTCTTCCTCTCTATCATTTTTGG - Intergenic
1135225670 16:20655005-20655027 TTAATCCAGTCTATCATTTTTGG - Intronic
1135225946 16:20657991-20658013 ATAATCCAGTCTATCATTTTTGG + Intronic
1137225037 16:46495598-46495620 TTAATCCAGTCTATCATTTTTGG - Intergenic
1137326556 16:47443505-47443527 TTAATCCAGTCTATCATTTTTGG - Intronic
1139171222 16:64631777-64631799 TTAATCCAGTCTATCATTTTTGG + Intergenic
1139367986 16:66445550-66445572 CTGTTCCAGTGTTACCTTCTTGG - Intronic
1140178236 16:72687181-72687203 TTGTTCCTCTGTATAATTTTTGG + Intergenic
1141177006 16:81727445-81727467 CAGGTACAGGGTATCATTTTTGG + Intergenic
1144089782 17:11845389-11845411 TTAATCCAGTCTATCATTTTTGG + Intronic
1147567811 17:41548325-41548347 CTGATCCAGTGTGTCAGTGTGGG - Intergenic
1148352899 17:46953431-46953453 CTAATCCAGTCTATCATTGTTGG + Intronic
1149391238 17:56193009-56193031 TTAATCCAGTCTATCATTTTTGG - Intronic
1150239516 17:63621145-63621167 CTGTTCCAGTGTAATATGTCAGG - Intergenic
1150607782 17:66708967-66708989 CTATTCCAATTTATCATTATGGG - Intronic
1150645629 17:66976006-66976028 CTGTTCCTGAGTATCAATCTGGG - Intronic
1150966087 17:69970310-69970332 CTTTTCCATTGTCTCAGTTTGGG - Intergenic
1153173696 18:2346203-2346225 TTAATCCAGTCTATCATTTTTGG - Intergenic
1153793298 18:8599336-8599358 TTGTTCCAGAGTATCTTTTTAGG + Intergenic
1154064666 18:11095866-11095888 CTGGGCCAGAGTATTATTTTTGG - Intronic
1155559715 18:27062544-27062566 CTTATCCAGTCTATCATTGTTGG + Intronic
1155578493 18:27276450-27276472 CTGGACCAGTGTAACATTTAAGG + Intergenic
1155712788 18:28903847-28903869 CTATTACAGTTTATCACTTTGGG - Intergenic
1156792082 18:40987923-40987945 TTGTTCCATTGTATTATTTTGGG + Intergenic
1157008572 18:43618014-43618036 TTAATCCAGTCTATCATTTTTGG - Intergenic
1157074252 18:44447761-44447783 TTAATCCAGTCTATCATTTTTGG - Intergenic
1157295342 18:46438121-46438143 TTGTGCCAATGTGTCATTTTTGG - Intronic
1159302540 18:66594612-66594634 TTAATCCAGTGTATCATTGTTGG - Intronic
1159308379 18:66675564-66675586 CTCTTCCAGTATATTTTTTTTGG + Intergenic
1159311961 18:66720702-66720724 TTAATCCAGTCTATCATTTTTGG - Intergenic
1159514924 18:69446440-69446462 TTAATCCAGTCTATCATTTTTGG + Intronic
1160629687 18:80238104-80238126 ATTTTCCAGTCTATCATTGTTGG - Intronic
1163097075 19:15066610-15066632 TTAATCCAGTCTATCATTTTTGG + Intergenic
1164317955 19:24111336-24111358 TTAATCCAGTGTATCATTGTTGG + Intronic
1164349668 19:27320552-27320574 TTAATCCAGTCTATCATTTTTGG - Intergenic
1165001346 19:32765496-32765518 TTAATCCAGTCTATCATTTTTGG - Intronic
926474072 2:13300351-13300373 CTGTTCCATTCTATCATTTGAGG - Intergenic
926478963 2:13364256-13364278 TTTATCCAGTCTATCATTTTTGG - Intergenic
928825416 2:35414569-35414591 CTAATCCAGTCTATCATTTTTGG - Intergenic
930415463 2:51085356-51085378 CTCTATCAGTGTAACATTTTAGG + Intergenic
930850540 2:55955963-55955985 TTAATCCAGTCTATCATTTTTGG + Intergenic
930958085 2:57228240-57228262 TTAATCCAGTCTATCATTTTTGG - Intergenic
931031528 2:58180327-58180349 CTTTTCCAGTCTATCATTGATGG - Intronic
931451952 2:62375396-62375418 CTCCTCCATTGTTTCATTTTTGG - Intergenic
932520749 2:72409474-72409496 TTGATCCAGTCTATCATTGTTGG - Intronic
932526114 2:72470850-72470872 TTGATCCAGTCTATCATTGTTGG + Intronic
933054769 2:77647931-77647953 TTAATCCAGTGTATCATTGTTGG - Intergenic
933095352 2:78171905-78171927 TTAATCCAGTCTATCATTTTTGG - Intergenic
933134271 2:78712175-78712197 TTGTTACAGTGTATCGTTTAAGG - Intergenic
933549062 2:83751607-83751629 CTGTTTCTGTTTATTATTTTAGG + Intergenic
933644019 2:84794935-84794957 TTAATCCAGTGTATCATTGTTGG - Intronic
934324318 2:91998033-91998055 TTAATCCAGTCTATCATTTTTGG + Intergenic
936777614 2:115993392-115993414 TTAATCCAGTGTATCATTGTTGG - Intergenic
936873555 2:117161647-117161669 TTAATCCAGTCTATCATTTTTGG - Intergenic
936906992 2:117548274-117548296 TTAATCCAGTGTATCATTGTTGG - Intergenic
937718672 2:125064530-125064552 CTGTTCCAATGTATCAATAGGGG - Intergenic
937974695 2:127575364-127575386 CCATTTCAGGGTATCATTTTGGG - Intronic
938782274 2:134595499-134595521 TTAATCCAGTCTATCATTTTTGG + Intronic
939665474 2:144946095-144946117 ATGTTCCAGTGTATATTCTTGGG + Intergenic
941558116 2:167009448-167009470 TTAATCCAGTGTATCATTGTCGG + Intronic
942104887 2:172624237-172624259 CTGCTCTAGTGTATCATCTCCGG - Intergenic
942382930 2:175411576-175411598 TTAATCCAGTCTATCATTTTTGG + Intergenic
943179066 2:184519455-184519477 CTTTTGCACTGTATTATTTTGGG + Intergenic
943316373 2:186393613-186393635 TTGTTCTAGTGTAAAATTTTTGG - Intergenic
943371649 2:187023425-187023447 GTGTCCAAGTGTATCATCTTAGG + Intergenic
943573416 2:189601809-189601831 TTGATCCAGTCTATCATTGTTGG - Intergenic
944253690 2:197602830-197602852 TTAATCCAGTCTATCATTTTTGG - Intronic
945460402 2:210101175-210101197 CTGGTCCTGGGTATCATTTTAGG - Intronic
946257043 2:218450332-218450354 CTGTTCCTCTGTATCCTTTACGG - Exonic
946441269 2:219698556-219698578 CAGTTCCTGGGTCTCATTTTAGG + Intergenic
946687402 2:222284254-222284276 CTGTTATAGTCTTTCATTTTGGG - Intronic
947074560 2:226328366-226328388 TTAATCCAGTCTATCATTTTTGG - Intergenic
947980062 2:234400925-234400947 TTGATCCAGTCTATCATTGTTGG + Intergenic
949079034 2:242082029-242082051 TTTATCCAGTCTATCATTTTTGG - Intergenic
1169623227 20:7531708-7531730 GTATTCCTGTGTCTCATTTTTGG - Intergenic
1169814256 20:9640445-9640467 TTGATCCAGTCTATCATTGTTGG + Intronic
1169834341 20:9861257-9861279 TTGATCCAGTCTATCATTGTTGG - Intergenic
1171525866 20:25810404-25810426 TTAATCCAGTCTATCATTTTTGG - Intronic
1171550961 20:26045480-26045502 TTAATCCAGTCTATCATTTTTGG + Intergenic
1171980919 20:31628195-31628217 TTAATCCAGTGTATCATTGTTGG - Intergenic
1172822017 20:37744932-37744954 CTGTTTCAGTGTATGATATAAGG - Intronic
1173369113 20:42419092-42419114 CTGTTACAGTGTCTCACTATTGG - Intronic
1173778159 20:45729534-45729556 CTAATCCAGTCTATCATTGTTGG + Intergenic
1174922487 20:54718643-54718665 TTAATCCAGTCTATCATTTTTGG + Intergenic
1175435724 20:58946154-58946176 AAGTTCCAGTGTCTCGTTTTTGG - Intergenic
1176350322 21:5789235-5789257 TTGATCCAGTCTATCATTGTTGG - Intergenic
1176357136 21:5909819-5909841 TTGATCCAGTCTATCATTGTTGG - Intergenic
1176544643 21:8187305-8187327 TTGATCCAGTCTATCATTGTTGG - Intergenic
1176563594 21:8370350-8370372 TTGATCCAGTCTATCATTGTTGG - Intergenic
1176593758 21:8671780-8671802 TTAATCCAGTCTATCATTTTTGG + Intergenic
1176776355 21:13137515-13137537 TTAATCCAGTGTATCATTGTTGG - Intergenic
1176777272 21:13149389-13149411 TTAATCCAGTGTATCATTGTTGG - Intergenic
1176890868 21:14317372-14317394 CTATTTCAGAGTATGATTTTTGG - Intergenic
1176916743 21:14634939-14634961 CTTTTCCAGTCTATCATTGATGG - Intronic
1177085924 21:16703776-16703798 TTGATCCAGTCTATCATTGTTGG + Intergenic
1177599467 21:23291272-23291294 ATCATCCAGTGTAGCATTTTCGG - Intergenic
1177708196 21:24736738-24736760 TTAATCCAGTCTATCATTTTTGG - Intergenic
1178116262 21:29420484-29420506 TTGATCCAGTCTATCATTGTTGG + Intronic
1178338877 21:31768411-31768433 TTTTTCCAGTGTATCATTGATGG + Intergenic
1178589805 21:33899863-33899885 CTGTTATAGTGGATTATTTTGGG + Intronic
1179780259 21:43695123-43695145 TTGTTTCACTGTATCAGTTTTGG - Exonic
1180503942 22:15972842-15972864 TTAATCCAGTCTATCATTTTTGG + Intergenic
1180551084 22:16541965-16541987 TTAATCCAGTCTATCATTTTTGG + Intergenic
1180583822 22:16867814-16867836 TTCATCCAGTCTATCATTTTTGG + Intergenic
1181561779 22:23707802-23707824 CTTTCCCATTGTATCTTTTTGGG - Intergenic
1184875122 22:47269519-47269541 CTGTTCCAGTCTCTCAGTGTTGG - Intergenic
1184886251 22:47346169-47346191 TTGATCCAGTCTATCATTGTTGG + Intergenic
1203249512 22_KI270733v1_random:103542-103564 TTGATCCAGTCTATCATTGTTGG - Intergenic
1203334636 22_KI270739v1_random:49670-49692 TTAATCCAGTCTATCATTTTTGG - Intergenic
949205452 3:1432905-1432927 ATGTTTCAGTGTATCCCTTTTGG + Intergenic
949303794 3:2616362-2616384 TTTTTCCAGTCTATCATTGTTGG + Intronic
949446270 3:4137229-4137251 TTAATCCAGTCTATCATTTTTGG - Intronic
951418095 3:22449486-22449508 TTGATCCAGTCTATCATTATTGG - Intergenic
951952923 3:28220973-28220995 ATTTTCCAGTCTATCATTGTTGG - Intergenic
952887996 3:38023306-38023328 CTGTGACAGTGTGTAATTTTGGG - Intronic
952918799 3:38270101-38270123 TTAATCCAGTCTATCATTTTTGG + Intronic
953077632 3:39584735-39584757 TTGATCCAGTCTATCATTGTTGG + Intergenic
957735865 3:84201631-84201653 TTAATCCAGTCTATCATTTTTGG + Intergenic
957871816 3:86098694-86098716 TTATTCCAGTCTATCATTGTTGG - Intergenic
958169485 3:89920119-89920141 CTGTTACGCTCTATCATTTTCGG + Intergenic
958210280 3:90466014-90466036 TTAATCCAGTCTATCATTTTTGG + Intergenic
958554052 3:95650825-95650847 TTGCTCCAGTCTATCATTGTTGG - Intergenic
958828315 3:99059047-99059069 TTGATCCAGTCTATCATTGTTGG + Intergenic
959237489 3:103743442-103743464 TTAATCCAGTGTATCATTGTTGG + Intergenic
959464720 3:106670922-106670944 TTGATCCAGTCTATCATTGTTGG - Intergenic
959488637 3:106959101-106959123 TTAATCCAGTCTATCATTTTTGG - Intergenic
959841343 3:110979692-110979714 CAGTTCCAGTGTTTTCTTTTTGG + Intergenic
961993736 3:131219150-131219172 TTTATCCAGTCTATCATTTTTGG - Intronic
962639437 3:137369546-137369568 TTAATCCAGTCTATCATTTTTGG + Intergenic
963892999 3:150656833-150656855 CTGTTTCAGGGTAAGATTTTGGG + Intergenic
964833794 3:160914673-160914695 TTGATCCAGTCTATCATTGTTGG + Intronic
964872489 3:161328815-161328837 CTGTTCCAGTTTATTTTTGTTGG - Intergenic
965126730 3:164639940-164639962 TTATTCCAGTCTATCATTGTTGG + Intergenic
965152310 3:164993805-164993827 CTGTTCCTGTGTATCTCATTGGG + Intronic
965436348 3:168657279-168657301 TTAATCCAGTCTATCATTTTTGG + Intergenic
965893906 3:173549891-173549913 CTTTTCCAGTGAACCATTATTGG + Intronic
966036523 3:175423649-175423671 CTAATCCAGTCTATCATTGTTGG + Intronic
967195677 3:187023493-187023515 CTAATCCAGTCTATCATTGTTGG - Intronic
967422095 3:189284588-189284610 TTAATCCAGTGTATCATTGTTGG + Intronic
967731993 3:192915736-192915758 CTGATTCAGTGTATCAGCTTTGG + Intronic
968259095 3:197304780-197304802 GTGTGCCAGTCTTTCATTTTTGG + Intergenic
969896744 4:10312384-10312406 TTGTCCCAGAATATCATTTTAGG - Intergenic
970749017 4:19335038-19335060 TTATTCCAGTCTATCATTGTTGG + Intergenic
970925451 4:21446381-21446403 TTAATCCAGTCTATCATTTTTGG - Intronic
971042999 4:22776100-22776122 TTAATCCAGTCTATCATTTTTGG - Intergenic
972724375 4:41733490-41733512 CTGTTCCATTGTAACATTTTTGG + Intergenic
973074223 4:45902924-45902946 TTTATCCAGTCTATCATTTTTGG - Intergenic
973075567 4:45920959-45920981 CTTTACCAGTGGATAATTTTAGG - Intergenic
973535333 4:51876174-51876196 TTGATCCAGTCTATCATTGTTGG - Intronic
973912438 4:55594736-55594758 CTGTTTTAGTTTATCATGTTTGG - Intergenic
974216431 4:58853286-58853308 TTAATCCAGTCTATCATTTTTGG - Intergenic
974548189 4:63339326-63339348 TTGATCCAGTCTATCATTGTTGG - Intergenic
974918397 4:68205591-68205613 TTGATCCAGTATATCATTGTTGG - Intergenic
975081670 4:70287519-70287541 TTGATCCAGTCTATCATTGTTGG - Intergenic
975209380 4:71681116-71681138 CTGTTTGTGTGTTTCATTTTTGG + Intergenic
975460981 4:74652494-74652516 TTAATCCAGTCTATCATTTTTGG + Intergenic
975881851 4:78919074-78919096 CTTTTCCAGTGTAGTGTTTTTGG - Exonic
976368151 4:84254224-84254246 TTGTTTCAGGGTATGATTTTAGG - Intergenic
977557946 4:98503672-98503694 TTATTGCAGTGTATTATTTTAGG + Intronic
977896508 4:102371609-102371631 CTTATCCAGTCTATCATTGTTGG + Intronic
978027063 4:103889935-103889957 TTAATCCAGTCTATCATTTTTGG - Intergenic
979096361 4:116555787-116555809 GTGTCCAAGTGTATCATTTTGGG - Intergenic
979763318 4:124434404-124434426 CAGTTCCCGTCTATCATTTGAGG - Intergenic
980311967 4:131142630-131142652 TTGATCCAGTCTATCATTGTTGG + Intergenic
980607233 4:135109045-135109067 TTAATCCAGTCTATCATTTTTGG + Intergenic
980786893 4:137567497-137567519 TTTATCCAGTGTATCATTTATGG + Intergenic
981419001 4:144527521-144527543 TTAATCCAGTCTATCATTTTTGG - Intergenic
982640815 4:157957804-157957826 CTTTTCCAAAGCATCATTTTTGG - Intergenic
982684547 4:158472484-158472506 TTAATCCAGTCTATCATTTTTGG + Intronic
982841303 4:160190368-160190390 TTAATCCAGTCTATCATTTTTGG + Intergenic
982872902 4:160606897-160606919 CTTTTCCAGTCTATCATTGATGG - Intergenic
983048924 4:163020910-163020932 TTAATCCAGTGTATCATTGTTGG - Intergenic
983085067 4:163433156-163433178 CTCTTCCAGTTTTTTATTTTTGG + Intergenic
983174192 4:164568848-164568870 TTAATCCAGTCTATCATTTTTGG - Intergenic
983295480 4:165862537-165862559 CTGTTCCAGTGATTACTTTTTGG - Intergenic
983717883 4:170808019-170808041 TTGATCCAGTCTATCATTTATGG - Intergenic
983967189 4:173826996-173827018 CTTTTCAAATGTAACATTTTAGG - Intergenic
984014697 4:174412280-174412302 TTGATCCAGTCTATCATTGTTGG + Intergenic
984239192 4:177196935-177196957 CTCTTTCTGTGTATCATATTTGG + Intergenic
984751199 4:183277364-183277386 TTAATCCAGTCTATCATTTTTGG + Intronic
986887211 5:12254047-12254069 TTAATCCAGTCTATCATTTTTGG - Intergenic
987667421 5:20962003-20962025 CTGTTCCTGTGAATGCTTTTAGG + Intergenic
987836843 5:23173025-23173047 TTTTTCCAGTCTATCATTTGTGG + Intergenic
988257709 5:28843386-28843408 TTAATCCAGTATATCATTTTTGG + Intergenic
988630984 5:32931300-32931322 CTAATCCAGTCTATCATTGTTGG + Intergenic
988638989 5:33020175-33020197 CTAATCCAGTCTATCATTGTTGG - Intergenic
988881390 5:35507392-35507414 TTTTTCCAGTCTATCAATTTAGG + Intergenic
988971881 5:36476846-36476868 TTATTCCAGTCTATCATTGTTGG - Intergenic
990071231 5:51785530-51785552 TTGATCCAGTCTATCATTGTTGG + Intergenic
990602752 5:57377643-57377665 TTAATCCAGTCTATCATTTTTGG - Intergenic
990627490 5:57630956-57630978 TTAATCCAGTCTATCATTTTTGG + Intergenic
990901866 5:60760022-60760044 CTAATCCAGTCTATCATTGTTGG + Intronic
991915879 5:71604965-71604987 TTAATCCAGTCTATCATTTTTGG + Intronic
992363399 5:76066205-76066227 TTAATCCAGTCTATCATTTTTGG - Intergenic
993069482 5:83141787-83141809 CTGTTCCAGATTAATATTTTGGG - Intronic
993313893 5:86374915-86374937 TTATTCCAGTCTATCATTGTTGG + Intergenic
993569120 5:89514102-89514124 CTGTTTCAGTGTACCCTTGTTGG - Intergenic
993787844 5:92165862-92165884 TTATTCCAGTCTATCATTGTTGG + Intergenic
993955458 5:94227154-94227176 TTGATCCAGTCTATCATTGTTGG - Intronic
994337996 5:98591608-98591630 TTAATCCAGTCTATCATTTTTGG - Intergenic
994444422 5:99855942-99855964 TTAATCCAGTCTATCATTTTTGG - Intergenic
994479643 5:100317654-100317676 TTGATCCAGTCTATCATTGTTGG - Intergenic
994544073 5:101140570-101140592 TTGATCCAGTCTATCATTGTTGG - Intergenic
995383771 5:111565972-111565994 TTAATCCAGTCTATCATTTTTGG + Intergenic
995644042 5:114291573-114291595 CTAATCCAGTCTATCATTGTTGG + Intergenic
996020254 5:118583122-118583144 CTAATCCAGTCTATCATTGTTGG + Intergenic
996114853 5:119606716-119606738 CTTTTTTAGTGTATTATTTTGGG + Intronic
996438178 5:123459115-123459137 TTAATCCAGTGTATCATTGTTGG - Intergenic
996629975 5:125618953-125618975 TTAATCCAGTCTATCATTTTTGG - Intergenic
997814970 5:137007896-137007918 CTTTTCCAGTCTATCATTGATGG - Intronic
998009105 5:138679060-138679082 TTATTCCAGTCTATCATTGTTGG + Intronic
998807066 5:145928510-145928532 TTAATCCAGTCTATCATTTTTGG - Intergenic
999836183 5:155375597-155375619 TTAATCCAGTGTATCATTGTTGG + Intergenic
1000685907 5:164248932-164248954 TTAATCCAGTCTATCATTTTTGG - Intergenic
1002865734 6:1120828-1120850 ATAATCCAGTCTATCATTTTTGG + Intergenic
1004889061 6:20080848-20080870 TTAATCCAGTGTATCATTGTTGG - Intergenic
1005834647 6:29698908-29698930 CTGGTGCAGTGGCTCATTTTGGG - Intergenic
1006884773 6:37371982-37372004 ATGTTCCAGTTAAGCATTTTAGG + Intronic
1008031275 6:46697583-46697605 CTTTTAAAGTGTTTCATTTTAGG + Intronic
1008106838 6:47448396-47448418 CTGTTTCAGTATATAAATTTGGG - Intergenic
1008375145 6:50782832-50782854 CTAATCCAGTCTATCATTGTTGG - Intergenic
1008534127 6:52494006-52494028 CTGTTCCAGGTTATTATCTTGGG + Exonic
1009350149 6:62664949-62664971 ATTTTGCAGTGTATCATTTATGG - Intergenic
1009599481 6:65779960-65779982 TTAATCCAGTCTATCATTTTTGG - Intergenic
1009899835 6:69797221-69797243 CTGTTCTAGTCTATCAACTTAGG - Intergenic
1010281380 6:74027211-74027233 TTAATCCAGTCTATCATTTTTGG + Intergenic
1010354770 6:74919551-74919573 TTCTACAAGTGTATCATTTTTGG - Intergenic
1010482265 6:76369814-76369836 TTAATCCAGTCTATCATTTTTGG + Intergenic
1010593921 6:77742003-77742025 TTGATCCAGTCTATCATTGTTGG + Intronic
1010633288 6:78226614-78226636 TTAATCCAGTCTATCATTTTTGG + Intergenic
1010665557 6:78625902-78625924 CTGTTCCAGGGTAAGATTTGAGG - Intergenic
1010834320 6:80568301-80568323 TTAATCCAGTCTATCATTTTTGG + Intergenic
1010842527 6:80663993-80664015 TTAATCCAGTCTATCATTTTTGG - Intergenic
1010911280 6:81560306-81560328 TTAATCCAGTGTATCATTGTTGG - Intronic
1010997394 6:82549573-82549595 TTGATCCAGTCTATCATTGTTGG - Intergenic
1011179754 6:84606890-84606912 TTCTCCCTGTGTATCATTTTGGG + Intergenic
1011404688 6:87006681-87006703 CTTTACCAGTGTATCATTGATGG - Intronic
1011832814 6:91393832-91393854 CTGGTCCAGTCTCTCCTTTTAGG + Intergenic
1011926021 6:92645685-92645707 TTAATCCAGTCTATCATTTTTGG - Intergenic
1012095103 6:94947754-94947776 CTTATCCAGTCTATCATTGTTGG - Intergenic
1012154035 6:95794195-95794217 TTGATCCAGTCTATCATTGTTGG - Intergenic
1012483356 6:99692280-99692302 ATGTGCCAGTCTATCATTGTTGG - Intergenic
1012732934 6:102904839-102904861 CTGTCCCAGTGTGTAGTTTTAGG - Intergenic
1012893514 6:104923364-104923386 CTGTTCCTGTATATTATTATTGG + Intergenic
1012895774 6:104946292-104946314 CTGTTCCTGTGTATGATTGAGGG + Intergenic
1013667043 6:112359591-112359613 CAGTTCCAGAATATCCTTTTTGG - Intergenic
1014312482 6:119821622-119821644 CTATTCTAGTGTGTCACTTTGGG - Intergenic
1014340993 6:120206639-120206661 CTGCTCCTGAGTAACATTTTAGG + Intergenic
1014579190 6:123113852-123113874 CTCCTACAGTGTATCATTGTAGG - Intergenic
1015322298 6:131889674-131889696 TTGATCCAGTCTATCATTGTTGG + Intronic
1015421935 6:133021100-133021122 CTAATCCAGTCTATCATTGTTGG + Intergenic
1015779216 6:136846727-136846749 TTGATCCAGTCTATCATTGTTGG + Intronic
1016317446 6:142806258-142806280 CTTTTCCACTCTATCATTTATGG - Intronic
1017654078 6:156610435-156610457 TTAATCCAGTCTATCATTTTTGG - Intergenic
1018075536 6:160209109-160209131 TTATTCCAGTCTATCATTGTTGG + Intronic
1018448503 6:163881717-163881739 TTGATCCTTTGTATCATTTTTGG - Intergenic
1018607012 6:165608495-165608517 TTATTCCAGTCTATCATTGTTGG + Intronic
1018670775 6:166175241-166175263 TTATTCCAGTCTATCATTGTTGG - Intergenic
1019067000 6:169310917-169310939 CTGTTCATGTTTATCATTTTGGG - Intergenic
1021107462 7:16654342-16654364 CTGTTCCATTGCATCACTTTAGG - Intronic
1022484571 7:30768445-30768467 CTCTTCAAGTCTATGATTTTTGG + Intronic
1023500277 7:40842756-40842778 CTGTTAGAATGTTTCATTTTTGG + Intronic
1023674451 7:42615673-42615695 CAGTTCCAGTTAATAATTTTTGG + Intergenic
1024031136 7:45460696-45460718 ATCTTCCAGTGTATCTTCTTTGG - Intergenic
1024893582 7:54230514-54230536 TTGATCCAGTCTATCATTGTTGG + Intergenic
1024900336 7:54311873-54311895 TTGATCCAGTCTATCATTGTTGG - Intergenic
1025572539 7:62594348-62594370 TTAATCCAGTCTATCATTTTTGG + Intergenic
1025594314 7:62905044-62905066 TTGGTCCAGTCTATCATTGTTGG - Intergenic
1025737684 7:64166233-64166255 CTAATCCAGTCTATCATTGTTGG - Intronic
1025794486 7:64725917-64725939 GTGATCCAGTCTATCATTGTTGG + Intergenic
1027917995 7:84351099-84351121 ATGTTCTAGTGTGTTATTTTAGG - Intronic
1028018618 7:85744349-85744371 CAGATCCAGTTTATCAATTTTGG - Intergenic
1028605406 7:92650197-92650219 ATGTATCTGTGTATCATTTTTGG - Intronic
1028664557 7:93326054-93326076 TTGATCCAGTCTATCATTGTTGG - Intronic
1029052397 7:97702506-97702528 TTAATCCAGTCTATCATTTTTGG - Intergenic
1029987812 7:104937725-104937747 TTTTTCCAGTGTATCATTGATGG + Intergenic
1030264245 7:107602191-107602213 CTGTTCGAGTGTGTCCTGTTTGG + Intronic
1030414540 7:109225771-109225793 CTGTTCCATTGTATTATGTAAGG + Intergenic
1030428838 7:109416139-109416161 TTGATCCAGTCTATCATTGTTGG + Intergenic
1030452109 7:109724864-109724886 TTGATCCAGTCTATCATTGTTGG - Intergenic
1030475647 7:110030511-110030533 CTAATCCAGTCTATCATTGTTGG + Intergenic
1030757364 7:113303647-113303669 TTTATCCAGTGTATCATTATTGG + Intergenic
1031001574 7:116421626-116421648 CAATTCCAATGTCTCATTTTAGG + Intronic
1031280662 7:119796066-119796088 TTGATCCAGTCTATCATTGTTGG + Intergenic
1031440621 7:121790106-121790128 TTAATCCAGTCTATCATTTTTGG + Intergenic
1031479287 7:122258635-122258657 TTAATCCAGTCTATCATTTTTGG + Intergenic
1031557010 7:123189977-123189999 CTTTTCTAGTCTTTCATTTTCGG + Intronic
1032296069 7:130639458-130639480 CTCTACAAGTGTGTCATTTTGGG - Intronic
1032437773 7:131914864-131914886 TTAATCCAGTCTATCATTTTTGG + Intergenic
1032931783 7:136680706-136680728 CTAATCCAGTCTATCATTGTTGG + Intergenic
1033904719 7:146188279-146188301 CTTTTCCAGTATAGCATTTTTGG + Intronic
1033984174 7:147202557-147202579 CTACTCCAGTCTATCATTCTTGG - Intronic
1035537296 8:402036-402058 TTTATCCAGTCTATCATTTTTGG - Intergenic
1035905654 8:3507388-3507410 CTAATCCAGTCTATCATTGTTGG + Intronic
1036631739 8:10520758-10520780 CTCTTCCAATGTAGCAGTTTGGG - Intergenic
1036990394 8:13585888-13585910 CTTTTTCAGTGTATTAATTTTGG + Intergenic
1037053080 8:14401671-14401693 TTGATCCAGTCTATCATTGTTGG + Intronic
1037056131 8:14444419-14444441 TTGATCCAGTCTATCATTGTTGG - Intronic
1037057447 8:14459725-14459747 CCTTTTCAGTGTATCATATTAGG - Intronic
1037069835 8:14630629-14630651 TTAATCCAGTCTATCATTTTTGG - Intronic
1037102139 8:15060276-15060298 TTAATCCAGTCTATCATTTTTGG - Intronic
1037176822 8:15957211-15957233 TTGATCCAGTCTATCATTGTTGG + Intergenic
1039022365 8:33222068-33222090 TTTATCCAGTCTATCATTTTTGG - Intergenic
1040082458 8:43301618-43301640 CTATTACAGTGTATCAGTCTAGG + Intergenic
1040092515 8:43412722-43412744 CTAATCCAGTCTATCATTGTTGG + Intergenic
1040702817 8:50088165-50088187 TTAATCCAGTGTATCATTGTTGG + Intronic
1041122629 8:54602420-54602442 TTGATCCAGTCTATCATTGTTGG + Intergenic
1041414517 8:57593117-57593139 TTAATCCAGTCTATCATTTTTGG + Intergenic
1041420539 8:57662842-57662864 TTAATCCAGTCTATCATTTTTGG + Intergenic
1041481546 8:58326440-58326462 CTGTTCCAGTATAGCATTTAAGG - Intergenic
1041590258 8:59572142-59572164 CTGGTCCATTGATTCATTTTAGG - Intergenic
1042128547 8:65563555-65563577 CTAATCCAGTCTATCATTGTTGG + Intergenic
1042129177 8:65570043-65570065 CTAATCCAGTCTATCATTGTTGG - Intergenic
1043118677 8:76292965-76292987 CTATTCCAAAGTAACATTTTGGG + Intergenic
1043172592 8:76983945-76983967 CTGTCCCACTGTGGCATTTTTGG + Exonic
1044070407 8:87753071-87753093 TTAATCCAGTGTATCATTGTTGG - Intergenic
1044073472 8:87790431-87790453 CTTTTCCAGTCTATCATTGATGG - Intergenic
1045077272 8:98584482-98584504 TTAATCCAGTCTATCATTTTTGG + Intronic
1045735733 8:105294703-105294725 CTGTTCCAGTGTATCATTTTTGG - Intronic
1046562265 8:115852872-115852894 TTGATCCAGTCTATCATTGTTGG + Intergenic
1048687202 8:136917798-136917820 TTAATCCAGTCTATCATTTTTGG + Intergenic
1048713965 8:137246291-137246313 CTAATCCAGTCTATCATTGTTGG - Intergenic
1048937349 8:139367982-139368004 TTGTTCCAGTCTATCGTTGTTGG - Intergenic
1050198411 9:3112910-3112932 TTAATCCAGTCTATCATTTTTGG - Intergenic
1050530141 9:6581438-6581460 CTGTTTCAGGGTCTGATTTTGGG + Intronic
1050628847 9:7537525-7537547 CTTTTCCAGTCTATCATTGATGG + Intergenic
1050659561 9:7868157-7868179 TTGATCCAGTCTATCATTGTTGG - Intronic
1050966349 9:11808824-11808846 CTGTCACAGTGTATTATTTTGGG + Intergenic
1051117719 9:13716211-13716233 TAGTTCCAGTGTTTCATTTATGG - Intergenic
1051142330 9:13991263-13991285 CTCTTGCAGTGGATAATTTTTGG + Intergenic
1051787990 9:20767208-20767230 TTAATCCAGTCTATCATTTTTGG + Intronic
1052347399 9:27424395-27424417 CTGTTCCTGTGTATCTCTTTGGG - Intronic
1052430021 9:28353760-28353782 TTGATCCAGTCTATCATTGTTGG - Intronic
1052632209 9:31056495-31056517 CTAATCCAGTCTATCATTGTTGG + Intergenic
1053583436 9:39431053-39431075 TTAATCCAGTCTATCATTTTTGG - Intergenic
1053847630 9:42255909-42255931 TTAATCCAGTCTATCATTTTTGG - Intergenic
1054105016 9:60989796-60989818 TTAATCCAGTCTATCATTTTTGG - Intergenic
1054425961 9:65067616-65067638 TTAATCCAGTGTATCATTGTTGG - Intergenic
1055247105 9:74259910-74259932 CTAATCCAGTCTATCATTGTTGG - Intergenic
1055578626 9:77685152-77685174 TTAATCCAGTCTATCATTTTTGG + Intergenic
1055860288 9:80742047-80742069 TTAATCCAGTCTATCATTTTTGG + Intergenic
1056100407 9:83295439-83295461 ATATTCCAGTTTTTCATTTTTGG + Intronic
1058239256 9:102536038-102536060 TTGATCCAGTCTATCATTGTTGG - Intergenic
1058257755 9:102790747-102790769 TTGATCCAGTCTATCATTGTTGG + Intergenic
1058265286 9:102891332-102891354 CTTTTCCCGTGTGTCACTTTGGG + Intergenic
1059293660 9:113250285-113250307 TTAATCCAGTCTATCATTTTTGG - Intronic
1059953269 9:119489935-119489957 CTGTTCCATTCTTTCCTTTTGGG - Intergenic
1203623891 Un_KI270749v1:152010-152032 TTAATCCAGTCTATCATTTTTGG + Intergenic
1186172741 X:6894604-6894626 CTGCTCCAGTGAGTCTTTTTTGG - Intergenic
1186597706 X:11001966-11001988 TTGATCCAGTCTATCATTGTTGG - Intergenic
1188075966 X:25775558-25775580 TTAATCCAGTCTATCATTTTTGG - Intergenic
1189700515 X:43713891-43713913 CTGTCCCTGTGTATCATTCCTGG - Intronic
1190272125 X:48873735-48873757 TTAATCCAGTCTATCATTTTTGG - Intergenic
1190357663 X:49620444-49620466 TTGATCCAGTCTATCATTGTTGG + Intergenic
1190383052 X:49857952-49857974 TTGATCCAGTCTATCATTGTTGG + Intergenic
1191003014 X:55681539-55681561 TTGATCCAGTCTATCATTGTTGG + Intergenic
1191130121 X:56999000-56999022 TTAATCCAGTCTATCATTTTTGG - Intergenic
1191145924 X:57165297-57165319 TTGATCCAGTCTATCATTGTTGG - Intergenic
1191188100 X:57635012-57635034 TTGATCCAGTCTATCATTGTTGG - Intergenic
1191196180 X:57725860-57725882 TTAATCCAGTCTATCATTTTTGG + Intergenic
1191261515 X:58327169-58327191 TTAATCCAGTGTATCATTGTTGG - Intergenic
1191744563 X:64472161-64472183 TTGATACAGTGTTTCATTTTGGG - Intergenic
1192628055 X:72750538-72750560 CTAATCCAGTCTATCATTGTTGG + Intergenic
1192653654 X:72970270-72970292 CTAATCCAGTCTATCATTGTTGG - Intergenic
1192983715 X:76373930-76373952 TTATTCCAGTCTATCATTGTTGG + Intergenic
1193008653 X:76649977-76649999 TTAATCCAGTGTATCATTGTTGG + Intergenic
1193026057 X:76847316-76847338 TTAATCCAGTGTATCATTGTTGG - Intergenic
1193034021 X:76930108-76930130 TTAATCCAGTCTATCATTTTTGG - Intergenic
1193177731 X:78414376-78414398 TTGATCCAGTCTATCATTGTTGG - Intergenic
1194007185 X:88509112-88509134 CTATTCCAGTGTAGGATATTTGG + Intergenic
1194055077 X:89121638-89121660 TTTATCCAGTCTATCATTTTCGG + Intergenic
1194173923 X:90624084-90624106 ATGTTCCAATGTATAAATTTGGG + Intergenic
1194213732 X:91101287-91101309 CTTATCCAGTGTATCATTGATGG + Intergenic
1194232053 X:91336436-91336458 TTAATCCAGTCTATCATTTTTGG - Intergenic
1194490234 X:94536673-94536695 TTTATCCAGTCTATCATTTTTGG - Intergenic
1194585976 X:95734866-95734888 CTAATCCAGTCTATCATTGTTGG - Intergenic
1194622478 X:96190259-96190281 TTAATCCAGTCTATCATTTTTGG - Intergenic
1194982082 X:100450854-100450876 CTGTGCCTGTGTTTCTTTTTTGG - Intergenic
1195409168 X:104550377-104550399 TTAATCCAGTCTATCATTTTTGG - Intergenic
1195413188 X:104591254-104591276 CTGTTCCAGTTTCTCTTTCTTGG - Intronic
1195417004 X:104631222-104631244 TTGATCCAGTCTATCATTGTTGG + Intronic
1195639878 X:107161389-107161411 TTGATCCAGTCTATCATTGTTGG - Intronic
1195851936 X:109293439-109293461 CTAATCCAGTCTATCATTGTTGG - Intergenic
1195901849 X:109806782-109806804 CTTTCCCAGTGCATCATATTAGG - Intergenic
1195911767 X:109895849-109895871 TTGATCCAGTCTATCATTGTTGG + Intergenic
1197316344 X:124970893-124970915 TTAATCCAGTGTATCATTGTTGG - Intergenic
1197579063 X:128259244-128259266 TTAATCCAGTGTATCATTGTTGG - Intergenic
1198380303 X:136077446-136077468 CTCTTCCATTGTAACATATTTGG - Intergenic
1198767716 X:140095484-140095506 CTGCCCCAGTGTCTCAGTTTTGG - Intergenic
1198926241 X:141799617-141799639 TTGATCCAGTCTATCATTGTTGG + Intergenic
1199115816 X:143990600-143990622 TTGATCCAGTCTATCATTGTTGG + Intergenic
1199314562 X:146362300-146362322 TTGATCCAGTCTATCATTGTTGG + Intergenic
1199488921 X:148377708-148377730 TTGATCCAGTCTATCATTGTTGG + Intergenic
1199611479 X:149619886-149619908 TTGATCCAGTCTATCATTGTTGG + Intronic
1199739715 X:150723237-150723259 TTGATCCAGTCTATCATTGTTGG + Intronic
1199750933 X:150816804-150816826 TTATTCCAGTCTATCATTGTTGG - Intronic
1199890455 X:152073836-152073858 TTATTCCAGTCTATCATTGTTGG + Intergenic
1199937324 X:152587651-152587673 TTATTCCAGTCTATCATTGTTGG - Intergenic
1200888943 Y:8301398-8301420 TTATTCCAGTCTATCATTGTTGG - Intergenic
1200956965 Y:8958949-8958971 TTGATCCAGTCTATCGTTTTTGG - Intergenic
1201541175 Y:15106559-15106581 TTAATCCAGTGTATCATTGTTGG + Intergenic
1201637521 Y:16141362-16141384 TTTTTCCAGTGTATCATTGACGG - Intergenic
1201677132 Y:16598506-16598528 TTAATCCAGTTTATCATTTTTGG + Intergenic
1201778451 Y:17692078-17692100 TTAATCCAGTGTATCATTGTTGG - Intergenic
1201823105 Y:18213914-18213936 TTAATCCAGTGTATCATTGTTGG + Intergenic
1202084704 Y:21123919-21123941 TTAATCCAGTCTATCATTTTTGG + Intergenic
1202165635 Y:21984590-21984612 TTGATCCAGTCTATCATTGTTGG + Intergenic
1202200267 Y:22339996-22340018 CTAATCCAGTCTATCATTGTTGG + Intronic
1202225723 Y:22601782-22601804 TTGATCCAGTCTATCATTGTTGG - Intergenic
1202317390 Y:23593879-23593901 TTGATCCAGTCTATCATTGTTGG + Intergenic
1202553375 Y:26076179-26076201 TTGATCCAGTCTATCATTGTTGG - Intergenic