ID: 1045745887

View in Genome Browser
Species Human (GRCh38)
Location 8:105421515-105421537
Sequence CAGTTCCAACTGACTTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045745887_1045745890 23 Left 1045745887 8:105421515-105421537 CCCACTGAAGTCAGTTGGAACTG 0: 1
1: 0
2: 1
3: 11
4: 139
Right 1045745890 8:105421561-105421583 GATAGATTTTTCATCCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045745887 Original CRISPR CAGTTCCAACTGACTTCAGT GGG (reversed) Intronic
902117276 1:14131953-14131975 CAATTCCCAATGACTTCATTTGG + Intergenic
903460486 1:23517184-23517206 CAAGTCCAACTGGCTTCAGCGGG - Intronic
905236042 1:36549058-36549080 CAGAACCAGGTGACTTCAGTGGG - Intergenic
905250084 1:36642862-36642884 CTGTTCCCACAGACTTCAGTGGG + Intergenic
909946554 1:81670395-81670417 CAGCTCCTACTGCCATCAGTGGG - Intronic
916266897 1:162899015-162899037 AAGATCCATCTGACTTCTGTAGG - Intergenic
916845446 1:168645413-168645435 CCATGCCAACTGACTTCAGCTGG + Intergenic
916865532 1:168853392-168853414 CAGGCCCATATGACTTCAGTGGG + Intergenic
920020428 1:202951630-202951652 AAGGTCTAACTGAGTTCAGTTGG - Intronic
923063246 1:230496119-230496141 TGGTTCCAACTGATTTCAGCCGG + Intergenic
1063199043 10:3769912-3769934 CATTTTCAACTGAATTCAATGGG + Intergenic
1064322531 10:14319220-14319242 GAGTTCCAACAGAGTACAGTGGG - Intronic
1065318748 10:24489149-24489171 CAGTTGTTACTGACTACAGTGGG + Intronic
1068437917 10:57015766-57015788 CACTTCCATCTGACTGCAGCAGG - Intergenic
1069915986 10:71787140-71787162 CTGTTCCATCTCACTTCAGGCGG - Intronic
1078938704 11:15976585-15976607 CAATTCCAAATGGCTTCTGTGGG - Intronic
1081436961 11:43037519-43037541 CAGTTCAAAGTGATATCAGTAGG + Intergenic
1082731623 11:56805240-56805262 AAAATTCAACTGACTTCAGTTGG + Intergenic
1087526239 11:99317052-99317074 CTGTTAAAACTGACTTCAGTTGG + Intronic
1087691746 11:101328444-101328466 CAGTTCCAATTGTCTTTGGTAGG + Intergenic
1093764153 12:22943009-22943031 CAGTTGGAACTGAGGTCAGTGGG + Intergenic
1098577018 12:72054117-72054139 CAGTTCCAACTCTCTTGAATGGG + Intronic
1098802681 12:74982033-74982055 CACTTCCACCTGACATCATTTGG + Intergenic
1098972339 12:76869482-76869504 CAATTCCAAATGACTTAAGAAGG - Intronic
1099306431 12:80962031-80962053 CAGGCCCAAATGACTTCACTTGG - Intronic
1100148204 12:91703087-91703109 CAGTTTCAACTGAGTTCTCTTGG - Intergenic
1101516187 12:105437851-105437873 CAGTTCCACCTGACTAGAGAGGG + Intergenic
1104456013 12:128913090-128913112 CTGTTTCAGCTGACTTGAGTTGG + Intronic
1104539445 12:129648965-129648987 GAGTTCCAACTGACTCCGGAGGG + Intronic
1106493996 13:30257855-30257877 CAGTTCCATCTCACTGCAATTGG + Intronic
1109401166 13:61830533-61830555 AAGTTCCAGCTGAGTTCATTAGG + Intergenic
1110696189 13:78493542-78493564 CAGCTCCCATTGATTTCAGTGGG - Intergenic
1112299476 13:98217104-98217126 CAGTTCCCACTGACATTAGTAGG + Intronic
1116559764 14:46362936-46362958 CAGTTCCAACTTGGTTAAGTTGG + Intergenic
1116743791 14:48792381-48792403 CAGTCCCTACTGACTTCCCTTGG - Intergenic
1118049785 14:62014190-62014212 CAGATCCAACTGCCTTCACGTGG + Intronic
1126107517 15:45156392-45156414 TTGTTCAAAATGACTTCAGTTGG + Intronic
1126318307 15:47394579-47394601 CAGTTCTTGCTGACATCAGTGGG + Intronic
1127636697 15:60877983-60878005 CAGCCCAAACTCACTTCAGTGGG - Intronic
1128800737 15:70495225-70495247 CTTTTCCAACTGTCTTGAGTCGG - Intergenic
1129067862 15:72922962-72922984 CAGGTCCAAATGATTTCACTTGG - Intergenic
1129200128 15:73993746-73993768 CAGTTCCAGGTGACCTCACTGGG - Intronic
1129290620 15:74564293-74564315 CAGTTTTAACTGATTTCAGGAGG - Intronic
1131928322 15:97411030-97411052 ATGTTCCAAGTGACTTCAGTGGG - Intergenic
1145387953 17:22431309-22431331 CATTTCCAAGTTACTTCATTTGG + Intergenic
1146647820 17:34587005-34587027 CAGTTCAAACTGACGGCAGTGGG + Intronic
1147554226 17:41466080-41466102 CAGGGCCAAGTGAGTTCAGTCGG - Exonic
1148134688 17:45284655-45284677 CAGTTCCAGCCGACCTCAGGTGG + Intronic
1149231129 17:54535935-54535957 CAGTCCCAACTGACATCACTTGG + Intergenic
1149395528 17:56237927-56237949 CAGTTCAATCAGCCTTCAGTGGG - Intronic
1150910266 17:69380594-69380616 CAGTTCAGACTGCCTTCAGCTGG + Intergenic
1155424394 18:25691099-25691121 CATTTCCAACTGTCATCAGAGGG + Intergenic
1158309460 18:56143101-56143123 CACTTCCAACACACTTCAGGAGG - Intergenic
1158646706 18:59254889-59254911 CAGAGCCAACAGACTGCAGTTGG + Intergenic
1159292204 18:66437860-66437882 CAATCCCAACAGTCTTCAGTGGG - Intergenic
1161232862 19:3183787-3183809 CAGTTCCATCTGTCTGCAATTGG - Intergenic
1162789183 19:13054245-13054267 CAGCTCCAGCTGACTTTGGTGGG + Intronic
1165057540 19:33187501-33187523 CATTTCCTCCTGAGTTCAGTGGG - Intronic
925729871 2:6911682-6911704 CAGATCCAGCTGACTCCATTTGG + Intergenic
926044940 2:9703490-9703512 CAGTGCCAAGAGACATCAGTGGG - Intergenic
927895105 2:26776457-26776479 CAGTGCCAACTGCCCGCAGTGGG - Exonic
930743577 2:54858504-54858526 CATTTCCAGCTGACCTTAGTTGG + Intronic
932551156 2:72771006-72771028 CATTTCCAACTTACTACACTTGG + Intronic
932614841 2:73225459-73225481 CAGTTCCCAGTGCCTTCAGTAGG - Intronic
933283801 2:80362008-80362030 CAGTTCAACCTGAATTCACTTGG + Intronic
934854276 2:97719244-97719266 CAGCACCAACCGACCTCAGTCGG + Intronic
935619554 2:105116938-105116960 CAGTGCCCACTGACTTCTGCAGG - Intergenic
938913831 2:135913929-135913951 CAGTTTCAACTGCCACCAGTAGG + Intronic
940287363 2:152045741-152045763 CAGTTCCAAGAGAGTTCAGACGG + Intronic
940778686 2:157910494-157910516 CAGCTCCACCTGACCTCTGTGGG + Intronic
943042093 2:182815739-182815761 CAGTTCCATCAGAGTTCTGTTGG - Intergenic
944034199 2:195273814-195273836 CAGTCCCAACTGAAATCATTGGG - Intergenic
945674785 2:212843053-212843075 TAGTTCCTAATGACATCAGTGGG - Intergenic
946202309 2:218077651-218077673 CAGGTCCAACAGACACCAGTCGG + Intronic
1169549324 20:6685896-6685918 CAGTTTCAAAAGACTTCAGCAGG - Intergenic
1169903338 20:10575078-10575100 CAGTTCTACCTGACCCCAGTGGG - Intronic
1171020045 20:21576671-21576693 CACTTCCCACTGACTTGGGTGGG + Intergenic
1174914662 20:54642389-54642411 CAGTTTAAACTGACTTGTGTTGG - Intronic
1175268126 20:57714842-57714864 CAGTGCCAACCGAGTCCAGTGGG - Intergenic
1176660149 21:9626919-9626941 CACTTGCAGCTGACCTCAGTTGG + Intergenic
1182693918 22:32183544-32183566 CAGATCCATCTGAATTCAGGGGG - Intergenic
1183371641 22:37435841-37435863 CAGTTCAAACTGGTTTAAGTTGG - Intergenic
952418061 3:33107483-33107505 CAATTCCACCTGACTTCTGCCGG + Intergenic
953002339 3:38947484-38947506 CATTTCCAAATGCCTTCTGTAGG - Intronic
954169492 3:48789305-48789327 GTGTTCCAATTGACATCAGTAGG - Intronic
964006755 3:151839099-151839121 CCGTTCCAACTGAATGCATTTGG - Intergenic
966589645 3:181667517-181667539 AAGTTTCAACTTACTTTAGTTGG - Intergenic
969554516 4:7897132-7897154 CATTTCCAACTGCCTTCTTTGGG + Intronic
971734016 4:30422720-30422742 CACTTACAAATTACTTCAGTTGG - Intergenic
973870759 4:55163804-55163826 CAGAGCCAAATGACCTCAGTTGG + Intergenic
974674024 4:65067900-65067922 CAGTTCCAAATGTCTGCAGCAGG - Intergenic
975411419 4:74055531-74055553 CAGTTCCAAATAACTTCAGTAGG - Intergenic
977305890 4:95323418-95323440 AAGTTCCATCTGACGTAAGTAGG + Intronic
978252353 4:106647902-106647924 GATTTCCAACTGTCTTCACTGGG - Intergenic
979677849 4:123429253-123429275 CACTTCCTCCTCACTTCAGTTGG + Intergenic
980089141 4:128423690-128423712 CAGGTCCTCCTGATTTCAGTAGG - Intergenic
981358807 4:143823804-143823826 CATTTCCAACTGTTTTCAGCAGG - Intergenic
985415206 4:189729489-189729511 CACTTGCAGCTGACCTCAGTTGG - Intergenic
985941166 5:3137412-3137434 TAGTTCCAACTGTCATTAGTTGG + Intergenic
986348362 5:6855008-6855030 CACTTCCATCTGAGGTCAGTTGG - Intergenic
994490034 5:100429883-100429905 AAGTTCCAAGTGACTTCAAAGGG - Intergenic
995101061 5:108306224-108306246 CACTTCCAACTGCCTCAAGTAGG + Intronic
996177283 5:120374599-120374621 CAGCTCCCACTCAATTCAGTAGG + Intergenic
997247664 5:132364743-132364765 CAGACCCCATTGACTTCAGTAGG + Intergenic
1001473776 5:172034889-172034911 CAGTTCCAAATGTCTTAAGTAGG + Intergenic
1002383995 5:178852025-178852047 CAGTTTAAACTGACTTAAGAAGG + Intergenic
1005169044 6:22960264-22960286 CATTTTCAACTGAATTAAGTTGG - Intergenic
1006473265 6:34239967-34239989 AAGTCCCATCTGACTCCAGTTGG + Intronic
1008232461 6:49000098-49000120 CAGTTGCAACTGAGTTAACTTGG + Intergenic
1008818918 6:55607653-55607675 CAGTTGCAGCTGACCCCAGTCGG - Intergenic
1010262652 6:73833914-73833936 CATTTCCAACTGATTTCAGCTGG - Intergenic
1010716601 6:79237375-79237397 CAGTTCCAACAGTTTTGAGTAGG - Intergenic
1011912442 6:92457931-92457953 AAACTCCAATTGACTTCAGTGGG - Intergenic
1012323732 6:97886719-97886741 CATTTCCAACTTCCTTCTGTGGG + Intergenic
1012631242 6:101470283-101470305 GAGTTCTAGCTGACTTGAGTTGG + Intronic
1013422140 6:109977081-109977103 CAGCTGCACCAGACTTCAGTAGG - Intergenic
1016566645 6:145462607-145462629 GAATTCCAACTGACATCTGTGGG - Intergenic
1018609396 6:165632826-165632848 CATTTCCTACTGACATCTGTGGG + Intronic
1023374870 7:39545972-39545994 CAGTTCAAACTGATTACAGCAGG + Intergenic
1023517103 7:41012053-41012075 CAGTTCAAACTGTCTCCATTTGG - Intergenic
1023684787 7:42723194-42723216 CAGTCCCCACTGACTACACTGGG - Intergenic
1024632777 7:51263017-51263039 CAGGTGGAACTGACATCAGTGGG + Intronic
1029175844 7:98663983-98664005 AAGATCCCACTGACATCAGTTGG + Intergenic
1029931601 7:104377064-104377086 CAGTCCCAACTAACTCCATTAGG + Intronic
1031515314 7:122692086-122692108 CACTTCCACCTGACTGCAGCAGG + Intronic
1033868174 7:145718126-145718148 CAGTTCGACCTGATGTCAGTGGG + Intergenic
1036769842 8:11571430-11571452 CAGCTCCACCTGACATCAGTCGG + Intergenic
1037284803 8:17287833-17287855 CAGGCCAAACTGACTACAGTAGG - Intronic
1040435307 8:47384784-47384806 CAGTGGCCACTGACTTGAGTCGG - Intronic
1041589764 8:59564247-59564269 CCTTGCCAGCTGACTTCAGTTGG + Intergenic
1045745887 8:105421515-105421537 CAGTTCCAACTGACTTCAGTGGG - Intronic
1048128173 8:131660962-131660984 CAGTTCAGACTGGCTTCTGTTGG + Intergenic
1050894318 9:10867796-10867818 CAGTTAACACTGGCTTCAGTGGG + Intergenic
1051261051 9:15265262-15265284 GAGCTCCCACTGGCTTCAGTAGG - Intronic
1056042060 9:82678321-82678343 CAATTGTAACTGACCTCAGTTGG - Intergenic
1056561055 9:87729653-87729675 CAGTTGCAACTGCCTTCATCAGG - Exonic
1059022599 9:110592756-110592778 CAGTTTCAGCTGCATTCAGTGGG + Intergenic
1062109439 9:134773925-134773947 CAGTTCCCGCTGCCTCCAGTGGG + Intronic
1203637717 Un_KI270750v1:128762-128784 CACTTGCAGCTGACCTCAGTTGG + Intergenic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1187577658 X:20575524-20575546 TAGTACCAACTGACTTAGGTTGG - Intergenic
1188103278 X:26117118-26117140 CAGTTCCATCTGATTTCATGAGG + Intergenic
1191598982 X:62982196-62982218 CAGTTTCAAATATCTTCAGTAGG + Intergenic
1193731026 X:85103635-85103657 CAGCTCCAATAGACTTCAGCTGG - Intronic
1194201606 X:90958647-90958669 CTGTCCCATCTGACCTCAGTCGG + Intergenic
1198147791 X:133875200-133875222 CATTTCCAACTGGCATCACTGGG + Intronic
1198601735 X:138291501-138291523 CAGTTCCCACTGGCTTCACTGGG - Intergenic
1200547446 Y:4534102-4534124 CTGTCCCATCTGACCTCAGTCGG + Intergenic
1202328534 Y:23720289-23720311 CTGTTCCAACTCATTTCATTGGG + Intergenic
1202542237 Y:25949764-25949786 CTGTTCCAACTCATTTCATTGGG - Intergenic
1202626707 Y:56867130-56867152 CAGTCCCAGCTGTCTTTAGTTGG + Intergenic
1202627852 Y:56879026-56879048 CAGTCCCAGCTGTCTTTAGTTGG - Intergenic