ID: 1045748686

View in Genome Browser
Species Human (GRCh38)
Location 8:105455853-105455875
Sequence TTCTACTCAACAGCTCCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 234}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045748686_1045748694 16 Left 1045748686 8:105455853-105455875 CCAAATGGAGCTGTTGAGTAGAA 0: 1
1: 0
2: 1
3: 33
4: 234
Right 1045748694 8:105455892-105455914 AGGGGCTTGGAAGAAAGGTCTGG No data
1045748686_1045748690 -2 Left 1045748686 8:105455853-105455875 CCAAATGGAGCTGTTGAGTAGAA 0: 1
1: 0
2: 1
3: 33
4: 234
Right 1045748690 8:105455874-105455896 AACATTGGTAATATAGCCAGGGG No data
1045748686_1045748695 17 Left 1045748686 8:105455853-105455875 CCAAATGGAGCTGTTGAGTAGAA 0: 1
1: 0
2: 1
3: 33
4: 234
Right 1045748695 8:105455893-105455915 GGGGCTTGGAAGAAAGGTCTGGG No data
1045748686_1045748689 -3 Left 1045748686 8:105455853-105455875 CCAAATGGAGCTGTTGAGTAGAA 0: 1
1: 0
2: 1
3: 33
4: 234
Right 1045748689 8:105455873-105455895 GAACATTGGTAATATAGCCAGGG No data
1045748686_1045748692 11 Left 1045748686 8:105455853-105455875 CCAAATGGAGCTGTTGAGTAGAA 0: 1
1: 0
2: 1
3: 33
4: 234
Right 1045748692 8:105455887-105455909 TAGCCAGGGGCTTGGAAGAAAGG No data
1045748686_1045748688 -4 Left 1045748686 8:105455853-105455875 CCAAATGGAGCTGTTGAGTAGAA 0: 1
1: 0
2: 1
3: 33
4: 234
Right 1045748688 8:105455872-105455894 AGAACATTGGTAATATAGCCAGG No data
1045748686_1045748691 3 Left 1045748686 8:105455853-105455875 CCAAATGGAGCTGTTGAGTAGAA 0: 1
1: 0
2: 1
3: 33
4: 234
Right 1045748691 8:105455879-105455901 TGGTAATATAGCCAGGGGCTTGG No data
1045748686_1045748696 18 Left 1045748686 8:105455853-105455875 CCAAATGGAGCTGTTGAGTAGAA 0: 1
1: 0
2: 1
3: 33
4: 234
Right 1045748696 8:105455894-105455916 GGGCTTGGAAGAAAGGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045748686 Original CRISPR TTCTACTCAACAGCTCCATT TGG (reversed) Intronic
902425196 1:16315423-16315445 TTCCACTCAACAGCTGTAATAGG + Exonic
903305424 1:22409503-22409525 ATCCTCTCAACAGCTCTATTAGG - Intergenic
903598810 1:24518468-24518490 TGCTAATCAATAGCTCCATCAGG + Intronic
904039704 1:27576742-27576764 CTGTTCTCAACAGCTCCACTGGG + Intronic
905602232 1:39263107-39263129 TTCTACTCTGCATTTCCATTTGG - Intronic
905708755 1:40082940-40082962 TTCAAGTCATCAGCTCCATGAGG - Intronic
906346668 1:45019774-45019796 TGCTACTCAAGTGCTCCCTTGGG - Intronic
906723034 1:48023170-48023192 CTCTACTCAGCAGCTCCCTTTGG - Intergenic
906748560 1:48238798-48238820 TTCTTCTTTATAGCTCCATTTGG - Intronic
906884395 1:49628923-49628945 TTAGACTCAGCAGCTGCATTTGG + Intronic
907179469 1:52556754-52556776 TTCTTCTCATCTGCCCCATTTGG + Intergenic
907758671 1:57336570-57336592 ATCTACACAACAGCTCTAGTAGG + Intronic
907925070 1:58948347-58948369 ATCTGCTCAACACCTCCATGTGG - Intergenic
909122353 1:71619144-71619166 TTTTACTGTACAGCTCCAGTTGG - Intronic
910941742 1:92543042-92543064 TTAAAGTCAACAGCTGCATTAGG + Intronic
911502612 1:98706947-98706969 CCCTACTCAATAGCTCCATTGGG - Intronic
911581771 1:99642683-99642705 GCCTACTCAACATCTCCATGTGG + Intergenic
912836614 1:113001858-113001880 TTCTAATCAACATATGCATTGGG + Intergenic
913038524 1:114999769-114999791 GTCTACTCAATATCTCCACTTGG - Intergenic
915960817 1:160265171-160265193 GTTTACTCAGTAGCTCCATTCGG - Intergenic
917109359 1:171529332-171529354 ATCAACTCAACATCTCCACTTGG + Intronic
917810939 1:178657916-178657938 GTCTACTCAACAGCTACACTTGG + Intergenic
918203420 1:182288359-182288381 CTCTACTAGACACCTCCATTTGG - Intergenic
920769054 1:208863270-208863292 TCCTACACAATGGCTCCATTTGG - Intergenic
921433856 1:215092985-215093007 TCCTACTTAACATCTCCACTTGG - Intronic
921741245 1:218687578-218687600 TCCTACTCAAAATCTCCACTAGG + Intergenic
922063456 1:222113626-222113648 CCCTACTCAACATCTCCATTTGG + Intergenic
923391610 1:233518340-233518362 CTCTCCCCAACATCTCCATTCGG + Intergenic
1063626201 10:7692198-7692220 CTCTTCTCAACAGCTCCACTAGG + Intergenic
1064127396 10:12675320-12675342 GTCTTCTCAGCAGTTCCATTTGG + Intronic
1064455946 10:15487668-15487690 CTTTACTCAACAGCTCCCTCAGG + Intergenic
1065252893 10:23834965-23834987 TCCTACTCCACATCTCCACTTGG - Intronic
1065289096 10:24212374-24212396 TTGTAGTCAACATCTCCACTTGG - Intronic
1066748904 10:38632516-38632538 TTCTACTACACAGTTCCTTTTGG - Intergenic
1066967759 10:42285269-42285291 TTCTACTACACAGTTCCTTTTGG + Intergenic
1070533763 10:77360276-77360298 TGCTAATCATCAGCTCCACTGGG - Intronic
1070653735 10:78256465-78256487 TTCTACTGAACAGCTCCTCAAGG + Intergenic
1071818544 10:89256249-89256271 CCCTACTCAACATCTCCATGTGG - Intronic
1072543367 10:96415007-96415029 TTCTACTCTACTGCTCCCCTTGG + Intronic
1076607413 10:131697976-131697998 ATCTTCTCAACAGCCCCATGTGG - Intergenic
1077717753 11:4598963-4598985 ATCTATACAACAGCTCCATGAGG + Exonic
1077890736 11:6416456-6416478 TTCTACTCAACATCTCCACTTGG + Intronic
1078810998 11:14762955-14762977 GCCTACTCAACATCTCCAGTTGG - Intronic
1079346492 11:19657060-19657082 TCCCACTCAACAGCACCACTTGG - Intronic
1081553383 11:44134725-44134747 TTCTACTCAACAGATAAACTGGG - Intronic
1081707908 11:45196326-45196348 GTGTACTTAACAGCTCCATGGGG + Intronic
1083527386 11:63381808-63381830 TTATAGTCCAAAGCTCCATTTGG - Intronic
1084565023 11:69923796-69923818 GTCTACTCCACAGCTCCGTCTGG + Intergenic
1085357977 11:75856812-75856834 GCCTACTCTACAGCTCCATTTGG + Intronic
1086124413 11:83335449-83335471 CTCTACCCAACATCTCCATTTGG - Intergenic
1086220600 11:84438160-84438182 TTCTCCTCCCCAGCTCCATTTGG + Intronic
1086852090 11:91821826-91821848 TTCTACTTCTCACCTCCATTTGG + Intergenic
1088145347 11:106670211-106670233 TTCTATTCAACAGGATCATTAGG + Intergenic
1090194627 11:124804068-124804090 TTTTAATCAACTGCTCCATCAGG - Intergenic
1090556379 11:127880734-127880756 ATCTACTCCACATCTCCATCTGG - Intergenic
1091110759 11:132964092-132964114 TTCCTCTCAACAGCACCATTAGG - Intronic
1092312827 12:7376543-7376565 TTCTACTTAGCATTTCCATTTGG + Intronic
1092836403 12:12493139-12493161 GTCTACTCAACATCTCCACTTGG + Intronic
1093903952 12:24667032-24667054 TTCTACTCAGTATCTCCACTTGG - Intergenic
1095566896 12:43634777-43634799 TTCCACTAAACAGCTCTACTTGG + Intergenic
1098036157 12:66303840-66303862 TTCTACTGAACAGCACCGGTCGG - Intronic
1098753301 12:74324096-74324118 GTCTACCTAACAGCTCTATTTGG - Intergenic
1101058563 12:100946649-100946671 TCTTACCCAACATCTCCATTGGG - Intronic
1102324069 12:111963707-111963729 ATCTACCCATCATCTCCATTAGG - Intronic
1104551023 12:129757499-129757521 GCCTACACACCAGCTCCATTTGG + Intronic
1107437269 13:40390982-40391004 TTCAAGTCAAAAGCACCATTTGG - Intergenic
1108728235 13:53204009-53204031 GCCTACTCAACATCTCCATTTGG + Intergenic
1109338062 13:61018084-61018106 GTATTCTCAACAGCTTCATTTGG - Intergenic
1110525244 13:76528677-76528699 TGCTACTTAACAGCTGCATAAGG + Intergenic
1112778175 13:102867811-102867833 ATCAACTCAACACCTCCACTGGG - Intronic
1113250629 13:108448762-108448784 TTCTGCTAAACACCTCCATCAGG + Intergenic
1117000752 14:51368897-51368919 TTATACTCAACAGCTGGTTTGGG - Intergenic
1119948548 14:78720266-78720288 GTCTACTTGACATCTCCATTTGG + Intronic
1121909481 14:97776129-97776151 TTCCACTCAAAAGCCCCATCTGG - Intergenic
1122829965 14:104391096-104391118 TTCTACTCTCCAGCTCCAAAGGG - Intergenic
1124067239 15:26355621-26355643 TTCTACTCAGCAGCTTATTTAGG + Intergenic
1124636647 15:31369371-31369393 TTCTTCACAACAACTCCATGAGG - Intronic
1124863465 15:33466051-33466073 TGCTACTCAACATCTCAACTTGG - Intronic
1126328679 15:47509028-47509050 TCCTCCTCTTCAGCTCCATTTGG + Intronic
1127577897 15:60310234-60310256 TACAACTCAACGGCTCCTTTGGG + Intergenic
1127893490 15:63275456-63275478 GCCTACTGAACACCTCCATTTGG + Intergenic
1128848247 15:70921484-70921506 GTCTACTCAACAGCTATTTTTGG - Intronic
1128880660 15:71239653-71239675 AACTACTCAACAGCTCCCCTGGG + Intronic
1130108474 15:80946417-80946439 TTCTAGAGACCAGCTCCATTTGG - Intronic
1131669697 15:94606818-94606840 TTATATTCTCCAGCTCCATTTGG - Intergenic
1135669184 16:24360599-24360621 TTCCACTGAGCAGCTCCATTTGG + Intronic
1139171294 16:64632870-64632892 TTCTAGGCGACAGCTCCATCTGG + Intergenic
1140558002 16:75943717-75943739 TTCTACCTGACATCTCCATTTGG - Intergenic
1140625163 16:76784760-76784782 TTATACTCAACAGACACATTGGG - Intergenic
1141142852 16:81508477-81508499 TTCTACTCCATAGCTCTATTTGG + Intronic
1142784979 17:2214146-2214168 TTGTTCTCAACAGCTCCACGAGG + Intronic
1144330783 17:14222327-14222349 TGCTACTCAACATCTCTATGTGG + Intergenic
1144806011 17:17968290-17968312 TACTTCTCAACAGCTGCATGGGG - Intronic
1146486748 17:33249300-33249322 ACCTACTCAACATCTCCATGTGG - Intronic
1146699641 17:34945316-34945338 TCCTAATCAACATCTCCATATGG + Intronic
1150200633 17:63353482-63353504 GTCTACTCAACATTTACATTTGG - Intronic
1154058989 18:11040993-11041015 TTCTACAAAACAGCTCCCTCTGG + Intronic
1155156676 18:23163442-23163464 TTCTACTCAACCTCTCGATACGG - Intronic
1156871175 18:41947070-41947092 TTCTTTTCAACAACTCCATGTGG - Intergenic
1158359908 18:56660253-56660275 TCCTACTCAACATCTCCTTTTGG - Intronic
1159257538 18:65966570-65966592 TTCTACTCAACATCTTCACATGG + Intergenic
1159732976 18:72054788-72054810 GTCTAGTCAACATCTCCACTTGG + Intergenic
1159789814 18:72764655-72764677 TCCTACTTAACGTCTCCATTTGG + Intronic
1168484750 19:56751449-56751471 TTCTTCTCTGCAGCTGCATTTGG - Intergenic
1168575157 19:57503229-57503251 ATCTGCTCCACTGCTCCATTTGG - Intronic
926185509 2:10687608-10687630 AACTACTCAACATCTCCATTTGG + Intronic
927103810 2:19807570-19807592 TTCCACTCAACATCTCACTTGGG - Intergenic
927320857 2:21744220-21744242 TTCTACTTACCATCTCCCTTTGG - Intergenic
927730043 2:25463104-25463126 GTCTACTCAACACCTCCCCTTGG + Intronic
929052171 2:37847159-37847181 GTCCACTCAACATCTCCAGTGGG + Intergenic
929323574 2:40577663-40577685 TTCTACTGAAAATCTCCAGTTGG - Intronic
929831014 2:45346227-45346249 CTCTAATCAACAGCTTAATTAGG + Intergenic
930597148 2:53402769-53402791 GCCTCCTCAACAACTCCATTTGG - Intergenic
931257743 2:60588354-60588376 ATTCACTCAACAGCTCCATGTGG + Intergenic
931690781 2:64833145-64833167 ATCTTCTCAGCAGCTCCATAAGG + Intergenic
931980708 2:67691266-67691288 TTCTACTCATCAGCCCCGATGGG + Intergenic
932396362 2:71451572-71451594 TACTTCTCAAAAGCTCCCTTGGG - Intergenic
933058953 2:77711062-77711084 TTCTTCTCAACATCTCCAGTTGG + Intergenic
934311894 2:91874643-91874665 TTCTACTACACAGTTCCTTTTGG - Intergenic
934860067 2:97757324-97757346 CTCCATTCAGCAGCTCCATTTGG - Exonic
935648192 2:105359164-105359186 TTCTAGTAAATAGCTCCAATTGG - Intronic
935689230 2:105715427-105715449 GTCTACTCAACATCACCACTTGG + Intergenic
937620740 2:123982028-123982050 TTCTAACCAACATCTCCCTTTGG - Intergenic
937865894 2:126751685-126751707 ATTTATTCAACAGATCCATTTGG + Intergenic
938565202 2:132512655-132512677 ATCTTCACAACAACTCCATTAGG - Intronic
940120597 2:150260349-150260371 TTCTAAATAACAGCTCCACTGGG - Intergenic
940274615 2:151925999-151926021 GCCTACTCAATACCTCCATTTGG - Intronic
941235544 2:162967857-162967879 TTCTACTCAAAATATCAATTAGG + Intergenic
942072301 2:172326958-172326980 CTTTACTGAACATCTCCATTTGG - Intergenic
943076141 2:183197580-183197602 GCCTACTCAACAACTCCACTTGG + Intergenic
943608977 2:190009620-190009642 GTCTATTTAACAGCTCCCTTTGG - Intronic
945489262 2:210435717-210435739 TTCTACTCAACAGCATTAATGGG - Intronic
946755300 2:222939375-222939397 TTCTACTCAGGAGCTCCCTCTGG + Intronic
947088042 2:226477723-226477745 TTTTACTCAAAAGATCCTTTTGG + Intergenic
947202207 2:227624069-227624091 TACTACTCAGCATTTCCATTGGG - Intronic
948132915 2:235614136-235614158 TTCTGCTCACCAGCACCAGTAGG - Intronic
948873597 2:240816075-240816097 TTCTACTCAACCTCCACATTAGG - Intronic
1169380188 20:5099623-5099645 GCCTCCTCAACAGCTCCACTTGG + Intronic
1170672903 20:18451625-18451647 ATCTACTCAACACCTCCACTTGG + Intronic
1172632606 20:36389135-36389157 TTCAACTCAACATCTCCACTTGG - Intronic
1173314489 20:41931140-41931162 TCCTTCTCCACAGCTCCACTAGG + Intergenic
1173819119 20:46009361-46009383 TTCTACCCCACAGCTGCATAAGG - Intronic
1173978019 20:47201983-47202005 TTCCACCCATCAGCTGCATTTGG + Intergenic
1174405162 20:50298143-50298165 TTCTTCTCAACAGCTTTACTGGG + Intergenic
1175077291 20:56386517-56386539 TTCTAGGCTACAGCTCCAGTTGG - Exonic
1175676293 20:60949309-60949331 TTTTTGTCAACAGCTCCCTTGGG - Intergenic
1177057152 21:16320111-16320133 TTCTACTCAATATCTCCACTTGG - Intergenic
1178366984 21:31996434-31996456 ATCTACCCAACAGCTCCAACAGG - Intronic
1183016249 22:34990123-34990145 TTCTAATCACCAGCTCTAGTGGG - Intergenic
1183826843 22:40395268-40395290 ACCTACTTAACAGCTCCACTTGG + Intronic
1184592118 22:45491791-45491813 TCCCACTTAAGAGCTCCATTAGG - Intergenic
949489260 3:4572218-4572240 TCCTACTCCACATGTCCATTTGG + Intronic
949719674 3:6974314-6974336 GTCTATTCAACATCTCCACTAGG - Intronic
952712441 3:36444827-36444849 TTCTACTTCACATCTCCATACGG + Intronic
954397094 3:50298683-50298705 TTCTACTCACCTGCTCCAGAGGG + Intronic
955345860 3:58161396-58161418 ATCTAGTAAACATCTCCATTTGG - Intronic
957410578 3:79834584-79834606 ATCAACTCAACATCTACATTAGG - Intergenic
957631216 3:82717733-82717755 TTCTCCTCATCAGCTGGATTTGG - Intergenic
959003160 3:100988545-100988567 TTGTACTCAAGACCTCTATTTGG + Intronic
959565411 3:107827750-107827772 TTCTCCTCAGCATCACCATTTGG + Intergenic
966913483 3:184572005-184572027 ATCTTCACAACAGCTCCATGAGG - Intronic
967871756 3:194235592-194235614 TTCTTCTCAACAACCCCATGTGG - Intergenic
968580782 4:1393251-1393273 TTCTACTCCAAACTTCCATTTGG + Exonic
970042876 4:11816631-11816653 TTGTTCTCAACAGCTGCTTTTGG - Intergenic
970050204 4:11905675-11905697 TTTTACTGGACAGCTCCACTGGG + Intergenic
971374676 4:26047425-26047447 GTCTGCTCAACATCTCCACTTGG - Intergenic
972462245 4:39315545-39315567 GTCTACTCAGCATCTCCATGTGG + Intronic
973654244 4:53029327-53029349 TTCTACTAAACTGCTCCAAGAGG + Intronic
974172281 4:58281730-58281752 TTCTTCTCAACATCTTCACTAGG - Intergenic
974269581 4:59633275-59633297 CTCTTCTCAACAGCTCCACTAGG + Intergenic
975632441 4:76416916-76416938 CTCTTCTTAACAACTCCATTAGG - Intronic
976401553 4:84612434-84612456 TTATACTCAACAGTTCAGTTTGG - Intronic
976944805 4:90751476-90751498 TTCTTCTCAAGAGCTCCTTGAGG + Intronic
977158427 4:93603695-93603717 TTCAAATCACCAGCTGCATTAGG - Intronic
977871923 4:102101695-102101717 TTCTATTCATTAGCTCCATCTGG + Intergenic
978174514 4:105712868-105712890 TTCTACTTGACATCTCCATGTGG - Intronic
979224842 4:118272902-118272924 CTCTACTCAACACTTCCACTTGG + Intergenic
979374106 4:119924226-119924248 TTCTACTCACTACCTCCATTAGG + Intergenic
980243490 4:130206503-130206525 TTCTTTGCAACATCTCCATTTGG + Intergenic
983286788 4:165750136-165750158 ATCTTCTCAAAATCTCCATTTGG + Intergenic
985364378 4:189211615-189211637 TTCTTCTCAATATCTTCATTAGG + Intergenic
988444618 5:31271684-31271706 TTCTAAACCACATCTCCATTTGG + Intronic
988868293 5:35359652-35359674 ATCTGCTCTACAGCTACATTAGG + Intergenic
989519835 5:42388736-42388758 ATCTTCTCAACACCTCCATAAGG + Intergenic
992998255 5:82353900-82353922 TTATAATGAACAACTCCATTTGG + Intronic
995809393 5:116087280-116087302 TTCTGCTGAAAAGGTCCATTTGG - Intronic
996820205 5:127618211-127618233 TTCTAGTCAACATCTACATATGG + Intergenic
997306732 5:132842782-132842804 TTCAACTCAAAAGCACAATTAGG + Intergenic
997691764 5:135832139-135832161 CTCTACTCAACACCTCCACCTGG - Intergenic
997731972 5:136188153-136188175 GCCCACTCAACACCTCCATTTGG - Intronic
999684778 5:154092421-154092443 TTTTTCACAACAGCTCCATCGGG - Intronic
999907324 5:156156300-156156322 TTCTGCTCAACAGCAAGATTTGG - Intronic
1000975223 5:167757191-167757213 ATCAACTCATCAGCTACATTAGG + Intronic
1000976860 5:167774508-167774530 ATCATCTCAACAGCTACATTAGG + Intronic
1001043230 5:168351833-168351855 GTCTACTCAACACCACCATTAGG - Intronic
1002111897 5:176921429-176921451 GTCTGCTCAACATCTTCATTTGG + Intronic
1002604509 5:180374525-180374547 TTCTGCTAAACACCTCCCTTGGG + Intergenic
1004776981 6:18858384-18858406 TGCTACTAAATATCTCCATTTGG - Intergenic
1005486528 6:26305591-26305613 CTCTTCTCAACAGTTTCATTTGG + Intergenic
1007468096 6:42069241-42069263 CTCTGCTCAACATCTCCAGTGGG - Intronic
1008504416 6:52215604-52215626 TTCCACTGGACATCTCCATTTGG - Intergenic
1008539885 6:52537410-52537432 TTCTACTCACCACTTCCTTTGGG + Intronic
1010565281 6:77403678-77403700 TCCTACTCACCATCTGCATTTGG - Intergenic
1011115720 6:83889365-83889387 TTCAAGTCACCAGCTGCATTAGG - Intronic
1011792398 6:90912636-90912658 TTCTACTCAACTACTCCATCAGG - Intergenic
1013378463 6:109542264-109542286 TTCTACTCTCCACCTCCATGAGG - Intronic
1014296212 6:119620840-119620862 GCCTACTCAACAACTCCCTTTGG - Intergenic
1014362015 6:120489911-120489933 TTCTACTCAACCACTACATTTGG - Intergenic
1014611128 6:123547948-123547970 TTCTATTCTACACCACCATTTGG + Intronic
1017770162 6:157638588-157638610 TTCTACTCAACAGCCACCATGGG + Intronic
1017854824 6:158341119-158341141 TTCTACTCAGAATCTCCATGAGG + Intronic
1017935873 6:159004446-159004468 GTCTACTCAACATCTCCACTTGG - Intergenic
1019192352 6:170259654-170259676 ACCAACTCAACAGCTCCCTTTGG + Intergenic
1020992907 7:15223893-15223915 TTTTCATCAACAGCTTCATTGGG + Intronic
1025044281 7:55679886-55679908 TTCAACTAGACAGCTCCATCTGG + Intergenic
1025137204 7:56428423-56428445 TTCAACTAGACAGCTCCATCTGG + Intergenic
1025241437 7:57279573-57279595 TTCAAATCAAGAGATCCATTAGG + Intergenic
1028854909 7:95579745-95579767 TTTTACTCAACAGGGCTATTTGG + Intergenic
1033594968 7:142852432-142852454 TTCTACTCAGCAGTTCCTTTTGG + Intergenic
1033974033 7:147077634-147077656 TTGTACTCAACCACTCCACTGGG - Intronic
1034496593 7:151427078-151427100 TTCTACCCAGCAGCCCCACTGGG + Intergenic
1036551771 8:9822159-9822181 TTCAACCCAACACCTACATTGGG - Intergenic
1036633411 8:10531159-10531181 TTCTGATCAACAGCCCCAGTAGG + Intronic
1038470294 8:27811068-27811090 TTCTCCTCCACAGCTTCTTTGGG + Exonic
1039178906 8:34841298-34841320 TTCTCCTCAAACTCTCCATTTGG + Intergenic
1039193098 8:34999192-34999214 ATCAACTCAACACCTACATTAGG - Intergenic
1039314641 8:36357587-36357609 CTTTACTCAACCTCTCCATTAGG - Intergenic
1039797831 8:40930460-40930482 GCCTACTCAACACCTCCATTTGG + Intergenic
1039909292 8:41811503-41811525 TTCTGCCCATCAGCCCCATTCGG + Intronic
1040058143 8:43079331-43079353 TTCAAGTCACCAGCTGCATTGGG - Intronic
1041941326 8:63391266-63391288 TTTTACACAACAGCTTTATTTGG + Intergenic
1043308678 8:78830322-78830344 TTCTATTCAACACCTCTATGAGG - Intergenic
1045748686 8:105455853-105455875 TTCTACTCAACAGCTCCATTTGG - Intronic
1045759625 8:105588898-105588920 ATCTTCTCAACAGCTCAATGAGG - Intronic
1047462254 8:125077717-125077739 TTCTTCTCAACAGCAACATGGGG + Intronic
1047827976 8:128598596-128598618 TTAAAGTCATCAGCTCCATTAGG - Intergenic
1050737864 9:8785082-8785104 TTCTATTGAACAGCTTCATAAGG - Intronic
1050853218 9:10315742-10315764 TTCTTCTCAATAGTTCCATGGGG - Intronic
1051091062 9:13408777-13408799 TTCTTCTCTCCAGCTTCATTGGG + Intergenic
1051463529 9:17351391-17351413 GTCTACACAACATCTCCTTTTGG + Intronic
1051528949 9:18078550-18078572 TTCTGCTCAACAGATACACTTGG + Intergenic
1052105838 9:24514602-24514624 TTTGATACAACAGCTCCATTAGG + Intergenic
1053010935 9:34632847-34632869 CTCTACTCAACATCTCCACTTGG - Intergenic
1054874131 9:70077447-70077469 TACTGCTCAATAGCCCCATTGGG - Intronic
1056260215 9:84841214-84841236 ATCTGCTCAGCAGCTCCACTTGG + Intronic
1057493755 9:95543524-95543546 GCCTACTCAACATCTCCATTTGG - Intergenic
1057947449 9:99341984-99342006 TTCTAATCAAAGGCTCCTTTCGG - Intergenic
1058186113 9:101857149-101857171 TTCTACTCAGCAGCTGAATATGG - Intergenic
1058564952 9:106273096-106273118 GTCTACTTAACATCTTCATTTGG - Intergenic
1059928067 9:119231982-119232004 TTCCACTCAACATCTACATTTGG + Intronic
1060790483 9:126482566-126482588 TCCTGCTCACCAGCTCCAGTTGG + Intronic
1062503876 9:136863018-136863040 TTATACACATCAGCTCCACTAGG + Intronic
1186930648 X:14385571-14385593 TTCAACTAAACAGCTTAATTAGG + Intergenic
1188153122 X:26703956-26703978 TTCAATTCCACAGCTCCCTTGGG - Intergenic
1188879148 X:35470835-35470857 ATCTACTCAACATCACTATTTGG - Intergenic
1189459028 X:41222112-41222134 TTCTACTGTATATCTCCATTTGG - Intronic
1189705807 X:43757703-43757725 GCCTACTCAACCCCTCCATTCGG + Intergenic
1190420517 X:50225845-50225867 TACTACTCCACATCTCCACTTGG - Intronic
1192512516 X:71731631-71731653 GTCTACTCAACATCTCCACTTGG - Intergenic
1192514181 X:71749878-71749900 GTCTACTCAACATCTCCACTTGG + Intergenic
1192526885 X:71854383-71854405 TTCTACTCAACATCTCCACATGG + Intergenic
1194330460 X:92578251-92578273 ATCAACTCATCATCTCCATTAGG - Intronic
1194922504 X:99783534-99783556 TCTTACTCACCAGCTCTATTAGG + Intergenic
1195730877 X:107965747-107965769 GTTTACTCAACATCTCCACTTGG - Intergenic
1196856288 X:119988506-119988528 ATCTCCACAACAGCTCCATGAGG + Intergenic
1196860042 X:120018008-120018030 ATCTCCACAACAGCTCCATGAGG - Intergenic
1198119108 X:133574332-133574354 TTTTTCTCAATAGCTTCATTGGG - Intronic
1198542807 X:137658117-137658139 TCCAACTCAACATCTCCACTGGG + Intergenic
1200639166 Y:5697321-5697343 ATCAACTCATCATCTCCATTAGG - Intronic