ID: 1045748691

View in Genome Browser
Species Human (GRCh38)
Location 8:105455879-105455901
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045748686_1045748691 3 Left 1045748686 8:105455853-105455875 CCAAATGGAGCTGTTGAGTAGAA 0: 1
1: 0
2: 1
3: 33
4: 234
Right 1045748691 8:105455879-105455901 TGGTAATATAGCCAGGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr