ID: 1045756064

View in Genome Browser
Species Human (GRCh38)
Location 8:105543736-105543758
Sequence TTGAATACACAAAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 567}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045756064_1045756066 11 Left 1045756064 8:105543736-105543758 CCTTCCTTCTTTTGTGTATTCAA 0: 1
1: 0
2: 2
3: 61
4: 567
Right 1045756066 8:105543770-105543792 TAAATCCTTCATTTTATTCCAGG No data
1045756064_1045756069 30 Left 1045756064 8:105543736-105543758 CCTTCCTTCTTTTGTGTATTCAA 0: 1
1: 0
2: 2
3: 61
4: 567
Right 1045756069 8:105543789-105543811 CAGGCGTAATACTACATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045756064 Original CRISPR TTGAATACACAAAAGAAGGA AGG (reversed) Intronic
901053081 1:6435420-6435442 CTGATTACACAAAAGAAACATGG - Intronic
902058916 1:13625218-13625240 TGGACTAAACAAAAGAGGGATGG - Intergenic
902481160 1:16712629-16712651 CTGATTACACAAAAGAAACATGG + Intergenic
903290666 1:22312218-22312240 ATGAATACATGACAGAAGGAAGG + Intergenic
904127251 1:28249786-28249808 TTGAATGAAAAAAGGAAGGAAGG + Intergenic
904792461 1:33033767-33033789 TTGAATACACAAAAGAAGACAGG - Intronic
905537395 1:38733500-38733522 TTGTATGGACAAAAGAAGGAAGG + Intergenic
906083720 1:43111667-43111689 TTGAATACACAATAGTAAAATGG - Intergenic
906573748 1:46868701-46868723 TTGAATAGACAAAATATTGAAGG + Intergenic
906598168 1:47098527-47098549 TTGAATAGACAAAATATTGAAGG - Intronic
907485562 1:54775617-54775639 CTGAATACATAAAATTAGGATGG - Intergenic
907643542 1:56217219-56217241 TGGAAGAAAGAAAAGAAGGAAGG + Intergenic
907759858 1:57347074-57347096 GTGATTACACAAAGGCAGGAAGG + Intronic
907774906 1:57504549-57504571 TTGGATACATAAATGAATGAGGG + Intronic
908409639 1:63850295-63850317 TATAATACACAAAAAAATGAAGG - Intronic
909186463 1:72492563-72492585 ATAAATAAATAAAAGAAGGAAGG + Intergenic
909314793 1:74202106-74202128 TTTAAAACAGAAAAGTAGGAAGG + Intronic
909428562 1:75557400-75557422 GTGAATACACAGAAGAAAGGTGG + Intronic
909700607 1:78517676-78517698 TTGAGGACACAGAAGAAGGTAGG + Intronic
910573386 1:88731066-88731088 TTGAATACCAGAAAGAAAGAAGG + Intronic
910632347 1:89368964-89368986 TTGAATACACAAGGGAAGGTAGG - Intronic
910772671 1:90845593-90845615 TTAAATACACAGAGGAAAGAAGG + Intergenic
912329754 1:108807871-108807893 TTAAAAACAGAAAAGAAGGCTGG - Intronic
912476729 1:109942563-109942585 TTGAATTCACAAAACATAGAAGG - Intergenic
912547392 1:110460802-110460824 AAGGATACACAAATGAAGGAAGG - Intergenic
914206509 1:145535048-145535070 TTTAATAAACAAAAGAGGCATGG + Intergenic
914353395 1:146860088-146860110 TGGAATTCCCGAAAGAAGGAAGG + Intergenic
914416179 1:147484668-147484690 TGGAATGCACACAAAAAGGAAGG - Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915986206 1:160467453-160467475 ATATATACACAAAAGAAGAAAGG - Intergenic
916421790 1:164644600-164644622 TTAAAAGCAAAAAAGAAGGATGG + Intronic
917677502 1:177333660-177333682 GTGAATACAAGAAAGCAGGAAGG + Intergenic
917948783 1:180006587-180006609 TTAAAAACAAAAAAAAAGGATGG - Intronic
918019001 1:180666005-180666027 ATCTATACCCAAAAGAAGGAAGG - Intronic
918149527 1:181786040-181786062 TTGAATGAACAATAGAAGAAGGG + Intronic
918683853 1:187390367-187390389 TTGAATACACAATACAAGAGGGG - Intergenic
919061586 1:192640902-192640924 TTGAAAACACAGAAGAAAGAAGG - Intronic
919603383 1:199649632-199649654 TGGAAAACAAAAAAAAAGGAGGG + Intergenic
920165721 1:204034429-204034451 CTCAATAAAAAAAAGAAGGAAGG - Intergenic
921083313 1:211762289-211762311 TTGAATTCACAAAAGAATGCTGG + Intronic
921198827 1:212784581-212784603 TAGAAAACACAAAATAATGAAGG + Intronic
921648285 1:217646163-217646185 TTCAAGACAGAAATGAAGGATGG - Intronic
923113892 1:230916277-230916299 TTTAATACTAAAACGAAGGATGG - Exonic
923643954 1:235796136-235796158 TAGAATACAAAAAAAGAGGAGGG + Intronic
923760325 1:236836689-236836711 TTTAAGACACAAATGAAAGATGG - Intronic
924501014 1:244638057-244638079 TTGAATATACAGAAGAGAGAAGG - Intronic
924600657 1:245485864-245485886 ATGAATAAATAAATGAAGGAAGG + Intronic
1062922951 10:1293435-1293457 TTAAACACACACAAGAAGAAAGG - Intronic
1063100862 10:2949100-2949122 TTGAAAAAAAAAAAGAAAGAAGG + Intergenic
1063549537 10:7017155-7017177 TTTTATAGACAAATGAAGGAAGG + Intergenic
1064044771 10:12002817-12002839 GCGAAAACACAAAAGAAGGCTGG - Intronic
1064196703 10:13249519-13249541 ATAGATATACAAAAGAAGGAAGG + Intergenic
1064770876 10:18721607-18721629 ATGAATACAGAAAAGTAGGAAGG - Intergenic
1064896318 10:20241478-20241500 CTGCATACACAAAAGAAGTAAGG + Intronic
1065088430 10:22204127-22204149 TTGAATAGACAAAAGAGAAATGG - Intergenic
1065372320 10:25000367-25000389 TAGAATAGACAAAATCAGGAAGG - Intronic
1066214277 10:33270759-33270781 CTGAAGACACAACAGGAGGAGGG + Exonic
1066284010 10:33946310-33946332 CTGAATATGTAAAAGAAGGAAGG + Intergenic
1066695633 10:38075370-38075392 TTGAATACAGAGAAGAAACATGG + Intergenic
1067482542 10:46613121-46613143 TTGAATACACATGAGAACCAAGG + Intergenic
1067612209 10:47728543-47728565 TTGAATACACATGAGAACCAAGG - Intergenic
1067669170 10:48304147-48304169 TTGAATACACACAAAAGAGAAGG - Intergenic
1068329476 10:55543873-55543895 TTGAAGAAAAAAAGGAAGGAAGG - Intronic
1068613528 10:59087026-59087048 TTTAATATAGGAAAGAAGGAAGG + Intergenic
1069043194 10:63716111-63716133 TTGAGAAAACAAAAGCAGGAAGG + Intergenic
1070002187 10:72386987-72387009 TTGAATTCCCAAAAGAAGTGTGG - Intronic
1070361449 10:75693815-75693837 TTGAATAAAAAAAAGCAGGATGG + Intronic
1071112695 10:82178726-82178748 ATAAATACCCAAAAGTAGGATGG + Intronic
1071546523 10:86534228-86534250 TTGAAATGACAACAGAAGGATGG - Intergenic
1071627632 10:87188784-87188806 TTGAATACACATGAGAACCAAGG - Intronic
1072155608 10:92721010-92721032 ATAAAAACACATAAGAAGGATGG - Intergenic
1072828172 10:98629493-98629515 CAAAAAACACAAAAGAAGGATGG - Intronic
1074147650 10:110730763-110730785 TGGGAAACACAAAGGAAGGAGGG - Intronic
1074184109 10:111086391-111086413 TTGAATGAATAAAGGAAGGAAGG - Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074615891 10:115067859-115067881 AGGAAGACAGAAAAGAAGGAAGG + Intergenic
1075105566 10:119538103-119538125 CTGACTACAGAAAAGAAGGAAGG + Intronic
1075202914 10:120421153-120421175 TTGAATACACTAATGAAGAAAGG - Intergenic
1075323695 10:121512768-121512790 ATGAATAAATAAAGGAAGGAGGG + Intronic
1075340169 10:121641055-121641077 ATGAATACAGACCAGAAGGATGG + Intergenic
1077528313 11:3082274-3082296 TAAAATACCCAAAAGGAGGAGGG - Intergenic
1077994066 11:7438250-7438272 TTGAAGATACAAGAGAGGGAGGG + Intronic
1078663910 11:13308858-13308880 ATGAACACACAAATGAATGAAGG - Intronic
1079974012 11:27070514-27070536 TTAAAAACAAAAAAGAAAGAGGG - Intronic
1080326830 11:31084691-31084713 TTTAATCTAGAAAAGAAGGAAGG - Intronic
1080694983 11:34595649-34595671 GTGTACACACAGAAGAAGGAAGG - Intergenic
1080716631 11:34808572-34808594 TTGCATAAACAAAAGAGAGATGG - Intergenic
1080955229 11:37085873-37085895 TTGAATAAATAAATGAATGAGGG - Intergenic
1080997506 11:37621797-37621819 TTGAATAAAACAAAGAAGGAAGG - Intergenic
1082045517 11:47722985-47723007 CTGAAAAGACAAAAAAAGGAAGG - Exonic
1082919490 11:58477704-58477726 TTGAAGTCAATAAAGAAGGAAGG - Intergenic
1083772455 11:64875885-64875907 ATGATTACAGAATAGAAGGATGG + Intronic
1085408734 11:76279190-76279212 TTGAATCAACAAAAGAAGGTGGG - Intergenic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085782858 11:79425093-79425115 TTCAAGACAGAAAAGCAGGAGGG - Intronic
1086480263 11:87228250-87228272 TGGAATAAATAAATGAAGGAGGG + Intronic
1086571058 11:88285130-88285152 TAGAATAAATAAAAGAAGGGTGG - Intergenic
1086782822 11:90929138-90929160 TTCAAAACATAAAAGAAAGAAGG - Intergenic
1087132094 11:94677445-94677467 TTGAATGCTGAAAAGAAGGCTGG - Intergenic
1087493189 11:98854177-98854199 TTGAAAACATTAGAGAAGGATGG - Intergenic
1087694549 11:101361698-101361720 TTGGATACAAAAAAAAAGGGGGG + Intergenic
1088725079 11:112627501-112627523 TAGAATCCACAAGAGATGGAAGG + Intergenic
1088971559 11:114779048-114779070 TTCAATACAAGAAAGAAAGATGG - Intergenic
1088987488 11:114922547-114922569 TTGGATGAACAAAAGAATGATGG - Intergenic
1089483000 11:118822287-118822309 TGGAAAAGACAAGAGAAGGAGGG - Intergenic
1089920065 11:122201195-122201217 TTGGATGCACGAAGGAAGGATGG + Intergenic
1090236691 11:125153467-125153489 TTGATTATACAAAGTAAGGAAGG - Intergenic
1090361280 11:126174695-126174717 TTGAATATATAAATGAAAGATGG - Intergenic
1091913610 12:4251577-4251599 TTGAAAGAACAAAGGAAGGAAGG + Intergenic
1092068776 12:5615531-5615553 TTGAGTAGACAAGAGGAGGAAGG - Intronic
1092575847 12:9782028-9782050 ATGAATGCACAGAAGAAGGCCGG - Intergenic
1092611003 12:10173324-10173346 AAGAATACACAAAGGAAGAATGG + Intronic
1092858482 12:12697368-12697390 TTGAAAACAAAAAAAAAGGCAGG + Intergenic
1093685771 12:22052365-22052387 ATGAATGAACGAAAGAAGGAAGG + Intronic
1093983593 12:25502229-25502251 TTGTATACAAAAAAAAAGGGGGG - Intronic
1094074781 12:26460506-26460528 TGGAAAGCACAAAAAAAGGAAGG + Intronic
1094138318 12:27152737-27152759 TTGATGACACAAAAATAGGAGGG + Intergenic
1094738744 12:33264429-33264451 AGGAATAAAGAAAAGAAGGAAGG - Intergenic
1096037320 12:48483782-48483804 ATGAAGTCAGAAAAGAAGGAGGG + Intronic
1096792977 12:54056516-54056538 TTGAGTTCTTAAAAGAAGGAAGG + Intergenic
1097426607 12:59453547-59453569 TTAAAAAAACAAAAGAAGGAGGG + Intergenic
1097638849 12:62154490-62154512 GTTAGTACAGAAAAGAAGGATGG + Intronic
1098073163 12:66698006-66698028 TTAAATACAGAAAAGAATTACGG + Intronic
1098139304 12:67435456-67435478 TTGAATGATGAAAAGAAGGAAGG - Intergenic
1098478357 12:70932943-70932965 TTAATAATACAAAAGAAGGAAGG - Intergenic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1098655541 12:73024642-73024664 CAGAATACCCAAAAGAATGAAGG + Intergenic
1099543592 12:83947273-83947295 TTTTATCCACAAAAGAGGGAAGG - Intergenic
1099696283 12:86024228-86024250 TGGAATACAGAATAGAATGATGG + Intronic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1100569205 12:95830971-95830993 TTTAATACACAAAAGAGATAGGG + Intergenic
1100779598 12:98009741-98009763 TTGAAAACTCAGAAGAGGGAGGG - Intergenic
1101638836 12:106570587-106570609 AGGAAGAAACAAAAGAAGGAAGG - Intronic
1101935959 12:109057342-109057364 TCAAAGACACAAAAAAAGGAGGG - Intronic
1101972808 12:109328008-109328030 TTTAAAACTCAGAAGAAGGATGG + Intergenic
1102790381 12:115639572-115639594 TTGTATATCCAAGAGAAGGAGGG + Intergenic
1102855689 12:116291233-116291255 TTGACTACAAAGAAGCAGGAGGG - Intergenic
1103492520 12:121333462-121333484 TTGAGTACATAAAAAAAGAAAGG + Intronic
1103531030 12:121601895-121601917 ATAAATAAAAAAAAGAAGGAAGG - Intergenic
1103790859 12:123469870-123469892 TTAAATAAAAAAAAAAAGGAGGG + Intronic
1103861006 12:124013949-124013971 TTGAATGAAGAAAAGAATGATGG - Exonic
1104232123 12:126895639-126895661 TTGAAGAAAGTAAAGAAGGAAGG - Intergenic
1104466037 12:128991496-128991518 ATGAATACAAAAAAGGGGGAGGG + Intergenic
1105483849 13:20806367-20806389 TTGCATACTAAAAAGAATGAAGG + Intronic
1105792148 13:23812291-23812313 TTAACTAGACAAGAGAAGGATGG + Intronic
1105812830 13:24009811-24009833 TTGAATTCCAAAAAGGAGGAGGG + Intronic
1105831762 13:24168739-24168761 TTCAAAACAAGAAAGAAGGAAGG + Intronic
1106625844 13:31420319-31420341 CTGGATACACACAGGAAGGAAGG + Intergenic
1109044714 13:57394694-57394716 TTGAATACATAAAAGGAGACAGG - Intergenic
1109184834 13:59255658-59255680 TTGAATGAAAAAAAGAAGGAAGG + Intergenic
1109239386 13:59865612-59865634 TCAAATAAACAAAAGATGGATGG + Intronic
1109442880 13:62398058-62398080 CTGAATTCCCAAAGGAAGGAGGG - Intergenic
1109581294 13:64339935-64339957 CTGAATTCCAAAAAGAAGGAGGG + Intergenic
1109983901 13:69949699-69949721 TTGAATACACCAATAAATGATGG - Intronic
1110072357 13:71192529-71192551 ATGAAAACACCAAAGGAGGAAGG - Intergenic
1110445501 13:75575354-75575376 TTAAAAACATAAAAGAAGAATGG + Intronic
1111071487 13:83173465-83173487 TGGAAAACACAAAAAAAGGCAGG + Intergenic
1111668486 13:91299687-91299709 ATGGATACATAAAACAAGGAAGG - Intergenic
1111817700 13:93174578-93174600 TGGAAAACACAAAAAAAGCAGGG + Intergenic
1111961901 13:94820863-94820885 TTCAATAAAAAAGAGAAGGAAGG - Intergenic
1112210236 13:97369492-97369514 TTAAAGACAGAAAAGAAGGCAGG - Intronic
1112351582 13:98639411-98639433 TAGAATACACAAAAAAATTATGG + Intergenic
1112876733 13:104051117-104051139 GTGAATGCACAAGAGAAGGAAGG - Intergenic
1113024847 13:105929176-105929198 CTGAATTCATAAAAGAATGATGG + Intergenic
1113130448 13:107030941-107030963 TTGAATAAATGAAGGAAGGAAGG - Intergenic
1114441177 14:22749331-22749353 TTGCAGAATCAAAAGAAGGAAGG + Intergenic
1114738244 14:25065293-25065315 TTAGATACACAAAAGAAAGCAGG - Intergenic
1116277323 14:42852278-42852300 TTGTATCCCCAAAATAAGGAGGG + Intergenic
1116796213 14:49393218-49393240 TGGAAAACAAAAAAAAAGGAGGG + Intergenic
1117097224 14:52311355-52311377 TTGAATAGACTAAAAAAGTAGGG - Intergenic
1117146478 14:52841148-52841170 TAGAATAAACAAAAGAGGGCCGG - Intergenic
1117851909 14:59981857-59981879 TTGAATACAGAAAATAAAGAGGG - Exonic
1117896193 14:60489685-60489707 TTGAATACACATAAGAGAAAAGG - Intronic
1118847459 14:69558486-69558508 TTCAAAAAAAAAAAGAAGGAAGG - Intergenic
1119608309 14:76040355-76040377 ATGAATACACAATAGAAGTCTGG - Intronic
1120202623 14:81554110-81554132 TTGAAAAAACAAAACAAGGCCGG + Intergenic
1120254613 14:82103289-82103311 TTGAATAGGGCAAAGAAGGATGG + Intergenic
1121399979 14:93667110-93667132 TTGAAAAAAAGAAAGAAGGAAGG + Intronic
1121433638 14:93904497-93904519 TTAAAAACAAAAAAGAAGAAAGG - Intergenic
1121977752 14:98421600-98421622 TTGAATACACTGAAGATGGATGG + Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122164339 14:99810294-99810316 TTGAACAAAGAAATGAAGGAAGG - Intronic
1122476767 14:102015494-102015516 TTGATTACACAAAAGTTGGCTGG - Intronic
1123914880 15:25013713-25013735 TTGACTTCATAAAAGATGGAAGG + Intergenic
1124389032 15:29236870-29236892 TGAAATAAAAAAAAGAAGGAAGG + Intronic
1125810071 15:42531619-42531641 CAGAAAACAAAAAAGAAGGAGGG - Exonic
1126302223 15:47210285-47210307 GGGAACACACAAAAGAAGGTGGG + Intronic
1127360725 15:58242802-58242824 TTTAATACCAAAAAGAAGGAAGG - Intronic
1127661573 15:61104393-61104415 TTGCAAACACAACAGGAGGATGG + Intronic
1127715940 15:61649577-61649599 TGGAAAACACAGAAGAACGAAGG - Intergenic
1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG + Intergenic
1128869777 15:71145619-71145641 CTGAATACAGAAAGGAAGAAAGG + Intronic
1129089363 15:73132349-73132371 GTGAAGAAACAAAAAAAGGATGG - Intronic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129496565 15:75987881-75987903 TTCAATAATCAAAAGCAGGAAGG + Intronic
1129942731 15:79512477-79512499 TTGCATATAGCAAAGAAGGAAGG - Intergenic
1129942795 15:79512836-79512858 TTGCATATAGCAAAGAAGGAAGG - Intergenic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130197360 15:81793140-81793162 TGGAAAGCAGAAAAGAAGGAAGG + Intergenic
1130302914 15:82693620-82693642 TTTTAAATACAAAAGAAGGAAGG + Intronic
1130379815 15:83361821-83361843 TTGAATAAACGAATGAATGAAGG + Intergenic
1130851448 15:87798238-87798260 TTGAATACAGGGAAGAAGGAAGG - Intergenic
1131358789 15:91770681-91770703 TTGAAGACACAAAAGATGCAAGG - Intergenic
1131580995 15:93643163-93643185 TTGAACATACAAAAAAAGGTTGG + Intergenic
1131801449 15:96073737-96073759 TTAAAAACACAAAACCAGGAAGG + Intergenic
1132272786 15:100540922-100540944 ATGAAAACACCAAAGAAAGAAGG - Intronic
1132905352 16:2279710-2279732 TTGAGAACCCCAAAGAAGGAAGG - Intronic
1133389301 16:5396337-5396359 CTGAATAGATGAAAGAAGGAGGG + Intergenic
1134125780 16:11615072-11615094 ATGAATGAACAAAGGAAGGAAGG + Intronic
1135068522 16:19332205-19332227 TTAAAAACAGAAAGGAAGGAAGG + Intergenic
1135182359 16:20286919-20286941 TTGAAGCCACAGAAAAAGGATGG - Intergenic
1135850958 16:25963363-25963385 TCTAAGACACACAAGAAGGAGGG - Intronic
1136038033 16:27555489-27555511 TTGAAGCCACAAAACAAGGTAGG - Intronic
1136658281 16:31727843-31727865 ATAAATACATAAAAGAAAGAAGG - Intronic
1137587245 16:49671009-49671031 GTAAATACATAAAAGAAGGGAGG + Intronic
1137948892 16:52762937-52762959 TTGAAGAAAAAAAAGAATGATGG - Intergenic
1138761277 16:59547641-59547663 TTGAATGGAGGAAAGAAGGAGGG - Intergenic
1138922273 16:61546219-61546241 TTGATAAGACAAGAGAAGGAAGG + Intergenic
1139086738 16:63596412-63596434 TTAAACACACAAAAGAATAAGGG - Intergenic
1139381826 16:66537331-66537353 TAGAATACACAGAAGAGGGATGG - Intronic
1139980628 16:70855430-70855452 TGGAATCCCCGAAAGAAGGAAGG - Intronic
1140602347 16:76492419-76492441 AAGAAAATACAAAAGAAGGATGG + Intronic
1140905875 16:79408639-79408661 GTGAAAAAAGAAAAGAAGGATGG - Intergenic
1140915468 16:79489365-79489387 TTCAGTACACAAAGGATGGATGG - Intergenic
1141260534 16:82449520-82449542 TTGAATAAACAAATGAATGAAGG + Intergenic
1143064957 17:4239908-4239930 GTGAATGTACATAAGAAGGAAGG - Intronic
1143082080 17:4389199-4389221 TTGAATGGGCAAAAGAAGGCGGG + Intergenic
1143791748 17:9301962-9301984 CAGAATACAGAAAAGAAGGAAGG - Intronic
1144195300 17:12889155-12889177 ATGAATACAAGAAAGAAGAAAGG - Intronic
1144333948 17:14252404-14252426 TAGAATACAAAAAAGAAGTCTGG - Intergenic
1144376509 17:14647630-14647652 GTGATTACAAAAAAGAAAGAAGG - Intergenic
1145764671 17:27450174-27450196 TTGAATAAACAAATGAGGGAGGG - Intergenic
1146242871 17:31246268-31246290 TTGCATAGACAAAAGAAGTAAGG - Intronic
1147142590 17:38467737-38467759 ATGAATGAACAAAAGAAGGAGGG - Intronic
1147247802 17:39133505-39133527 TTGAATGAACAAAGGAAGTAGGG - Intronic
1147533829 17:41304721-41304743 ATGAATACAGACAAGAAGGAGGG - Intergenic
1148764004 17:50027080-50027102 TTGAATAAATAAATGATGGATGG - Intergenic
1149982004 17:61318161-61318183 TAGAACACACCAAAAAAGGATGG + Intronic
1153398929 18:4660322-4660344 GTAAATACAAAAAAGAAGTATGG + Intergenic
1153404192 18:4717464-4717486 TGGAACACAGAAAAGACGGAAGG - Intergenic
1153596158 18:6727401-6727423 GTGAATTCACAAGAGGAGGAGGG + Intergenic
1153699160 18:7675241-7675263 TTTAAAACATTAAAGAAGGAAGG - Intronic
1153704502 18:7732080-7732102 TGGAAAACACAAAATAAGAATGG + Intronic
1153957765 18:10112669-10112691 TTCAATAAACAAAAGAATAAAGG - Intergenic
1154050607 18:10952918-10952940 TAGAATGAAAAAAAGAAGGAAGG - Intronic
1156528867 18:37795789-37795811 TTGAATCCCCAACAGAATGATGG - Intergenic
1156883632 18:42109276-42109298 TTTAAAACACAAGAGAAGGAAGG - Intergenic
1157882981 18:51339773-51339795 TTGAAGACAAAAAAAAAAGAAGG + Intergenic
1157892686 18:51433105-51433127 TTGAATTGACAAAAGAATAATGG + Intergenic
1159013789 18:63084555-63084577 TTTAAAACACAAATGCAGGATGG + Intergenic
1159104330 18:63988188-63988210 TTGCATACACATAATAGGGAAGG - Exonic
1159200400 18:65176041-65176063 TTGAATTTACAAAATCAGGATGG - Intergenic
1159636958 18:70816690-70816712 TTGAAAATACAAAAAAAAGAAGG + Intergenic
1159726768 18:71970503-71970525 TTGAATACATAAATAAATGAAGG + Intergenic
1160241374 18:77125739-77125761 TTTGATACAAAAAAAAAGGAGGG - Intronic
1162152197 19:8654688-8654710 TTGAATCAACCAATGAAGGAGGG + Intergenic
1162441572 19:10695555-10695577 TTGATTGCGCAAAGGAAGGAAGG - Intergenic
1164495736 19:28759161-28759183 TGGAAAACAAAAAAGAAGCAGGG + Intergenic
1167101428 19:47406528-47406550 TGGAAGACAAAAAAAAAGGAGGG + Intronic
1167290715 19:48624072-48624094 TTGAATTCACAAAAGAAAAGGGG - Intronic
1167699925 19:51036960-51036982 TTGAATACAAAAAATAAGGCGGG + Intergenic
1168075891 19:53980867-53980889 TAGAATACAGAGAAGAGGGAGGG + Intronic
1202715195 1_KI270714v1_random:38533-38555 CTGATTACACAAAAGAAACATGG + Intergenic
926397452 2:12458535-12458557 TTGAATACATAAAATAATAATGG - Intergenic
926428009 2:12757347-12757369 ATAAATACACAAAGGAAGGAAGG - Intergenic
927096755 2:19753155-19753177 GTGAATACACTAAATCAGGATGG - Intergenic
927224838 2:20753972-20753994 TTAAACATACATAAGAAGGAAGG + Intronic
927675771 2:25104928-25104950 TTAAATGCACACAAGAAGCAGGG - Intronic
928087450 2:28354927-28354949 TGAAACACACAAAAGAAGAAGGG - Intergenic
928438318 2:31270516-31270538 TTGAATATAAAAAAGATCGATGG - Intergenic
928574244 2:32638676-32638698 TTCAATAGAAGAAAGAAGGAGGG - Intronic
928838919 2:35581611-35581633 GTGTATACACAAAAGGAGGGGGG + Intergenic
928937778 2:36698411-36698433 TTGAATACAGGAAAGCAGTATGG + Intronic
929038311 2:37718541-37718563 ATGAATACACATGAGAAGAAGGG - Intronic
929648911 2:43657906-43657928 TTGTAGATACAGAAGAAGGAGGG - Intronic
929883100 2:45854247-45854269 CTGACTACACAAAACAAGTATGG + Intronic
929891786 2:45924368-45924390 TTGAATAGGAAAATGAAGGATGG + Intronic
930734247 2:54758999-54759021 TTGAAAACAAAAAATAGGGATGG + Intronic
931244558 2:60481312-60481334 TTGAAAACAAAAATGAAGCAGGG + Intronic
931675676 2:64693885-64693907 TAAAATACTCAAAAGAAGGGAGG - Intronic
932001174 2:67886518-67886540 TTAAGGACACAAAATAAGGATGG - Intergenic
932123345 2:69121123-69121145 ATGAGCACACAAAAGGAGGAGGG - Intronic
932136655 2:69236971-69236993 AAAAATACACAAAAAAAGGAAGG - Intronic
932208803 2:69909536-69909558 TTGCAGACAAAAAAGAATGATGG - Intronic
932492368 2:72130563-72130585 TCGAAAACACAGAAGAATGAAGG - Exonic
932846313 2:75139020-75139042 TTAAATACATAAAGGATGGATGG + Intronic
933409279 2:81904523-81904545 TTGAATAAATAATAGATGGAAGG + Intergenic
933444595 2:82363694-82363716 TTGAATGAAGAAAAGAAGAAAGG - Intergenic
934474429 2:94584655-94584677 CTGATTACACCAAAGTAGGAGGG + Intergenic
935508651 2:103940937-103940959 TTGACAACAGAAAATAAGGACGG + Intergenic
935893603 2:107708441-107708463 AGGAATAAACAAAAGCAGGATGG + Intergenic
936135316 2:109888079-109888101 AGGAATACACAAAATAAGGCTGG + Intergenic
936209381 2:110483406-110483428 AGGAATACACAAAATAAGGCTGG - Intergenic
936266100 2:111008513-111008535 TTAAATACACAAGAGAGGGGTGG - Intronic
936406524 2:112209683-112209705 TTGAAGTCACAAAAGGAAGATGG + Intergenic
936428567 2:112438645-112438667 AGGAATACACAAAATAAGGCTGG - Intergenic
936679766 2:114757024-114757046 TTGAATATAGGAAGGAAGGAAGG + Intronic
936691053 2:114889077-114889099 GTGAAAACACTAGAGAAGGATGG + Intronic
937282112 2:120725475-120725497 TTGAATACAAAAAAAAAAGATGG - Intergenic
937486499 2:122320671-122320693 ATGACTAGACAAAGGAAGGAAGG - Intergenic
937608679 2:123834056-123834078 AGGAAAACACAAAAGAAGCATGG - Intergenic
937734030 2:125267801-125267823 ATGAATCCACAAAACAAAGATGG + Intergenic
938576826 2:132612189-132612211 TTGATTCTACAAAGGAAGGAAGG - Intronic
938657909 2:133453725-133453747 AGGAAGAAACAAAAGAAGGAAGG + Intronic
939142051 2:138366060-138366082 TTAAATACACAAATGAAAAAAGG + Intergenic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
939223749 2:139338755-139338777 ATGATGACACAAAAGAAAGAAGG + Intergenic
939894352 2:147773805-147773827 TTGCCAACACAAAAGAAGGAAGG - Intergenic
941521034 2:166543368-166543390 ATAAATAAACAAAAGAAAGAGGG + Intergenic
941593219 2:167445685-167445707 TTGAAAACAAAAAAAAAGCAGGG - Intergenic
941767268 2:169312024-169312046 TGGAAAACACAAAAAAAGGCAGG - Intronic
942013750 2:171790343-171790365 CTGAAAAGACAAAGGAAGGAAGG - Intronic
942337872 2:174909946-174909968 TTAAATATACAAAATAAGGCAGG + Intronic
942473331 2:176286422-176286444 TTGAAAACACAGAAAAAGGAAGG - Intronic
942873435 2:180764157-180764179 TTGGTTACACAAAAGAGGGAGGG + Intergenic
943107055 2:183558649-183558671 TTGAATGTACATAAGAAAGAAGG - Intergenic
944130504 2:196342490-196342512 TGGAATATATAGAAGAAGGAAGG - Intronic
944240355 2:197480022-197480044 TTGAATTTACAAAAGAAAGTAGG - Intergenic
944783234 2:203041303-203041325 TGAAATACACATAAGAAGAAAGG + Intronic
944785434 2:203065446-203065468 GTGAGTACAAAAAAGAAGCATGG + Intronic
944914102 2:204340181-204340203 TTGAAAACTTAAAAGAATGAAGG + Intergenic
945047814 2:205797546-205797568 TTGAATGCTAAAAAGAAGCAGGG + Exonic
947037595 2:225876733-225876755 TTGAATACATAAATGAATTAAGG + Intergenic
947615487 2:231554470-231554492 CTGAGTACACAGACGAAGGAAGG - Intergenic
947781918 2:232774800-232774822 TTGAAAATACAAAAGAATCATGG - Intronic
948554553 2:238798796-238798818 TTAACTTCACAAAATAAGGAAGG + Intergenic
1170305748 20:14935946-14935968 TGGAAAAAAGAAAAGAAGGAAGG - Intronic
1171559387 20:26109213-26109235 CTGAATACAAAAAAGAATGAAGG + Intergenic
1172747647 20:37225240-37225262 TAGGAGACACAAAAGAAAGAAGG - Intronic
1173306509 20:41855745-41855767 TTGAATAAACAGAATAAGGGAGG + Intergenic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1174267395 20:49341519-49341541 TTGAGTAAAGAAAAGAAGGCTGG - Intergenic
1174625355 20:51909720-51909742 TTGAATGGCCAAAAAAAGGAGGG + Intergenic
1175127861 20:56765781-56765803 TTGAACAAACAAAATAAGAACGG + Intergenic
1175344133 20:58259356-58259378 AGGAAAAAACAAAAGAAGGAAGG + Intergenic
1175749482 20:61485408-61485430 TTGGATCCACAGAGGAAGGAGGG - Intronic
1175988111 20:62774354-62774376 TTGTGCACACAAAGGAAGGAGGG - Intergenic
1176977327 21:15336881-15336903 TTGAAAACAAAAAAGAAAGTTGG + Intergenic
1177460936 21:21409812-21409834 TTAAATACACAAAATTAGGCTGG + Intronic
1178026710 21:28476765-28476787 TTGAACTCACCAAATAAGGAGGG + Intergenic
1178422871 21:32456186-32456208 TAAAAGACACAAAAGAAGGCTGG - Intronic
1178896356 21:36561837-36561859 TTGTATCCAGAAAAAAAGGAGGG - Intronic
1179230963 21:39503426-39503448 TTTAACACACAAATGAAGGCAGG - Intronic
1179424601 21:41265168-41265190 TTGAAAAAAAAAAAAAAGGAAGG - Intronic
1179681685 21:43026167-43026189 ATGAATGCAGAAAAGCAGGAGGG - Intronic
1180013095 21:45064277-45064299 TGTAAAACACAACAGAAGGAGGG - Intergenic
1182190955 22:28460160-28460182 TTGAATAAGCAAAAGAAGCCAGG + Intronic
1182739599 22:32558135-32558157 TTGAATGAAAAAAAGAAAGAAGG + Intronic
1182838547 22:33364381-33364403 TTGAAAAAACAAAAGATGGGAGG - Intronic
1184197443 22:42939642-42939664 TAGAACACACAATGGAAGGATGG + Intronic
1184298502 22:43541284-43541306 TTGAATCCTCAGAAGAAGCAGGG + Intronic
949131572 3:508233-508255 CTGAATGCACAAAAGCTGGAAGG - Intergenic
950218992 3:11180057-11180079 TTTAAAACACAAAAGAGGGCCGG - Intronic
950243047 3:11388728-11388750 ATGAATAAAAAAAAGAAAGAAGG - Intronic
950668393 3:14511017-14511039 TGGAATGAACAAATGAAGGAGGG - Intronic
951498749 3:23360334-23360356 TTTGTTACACAAAGGAAGGAAGG - Intronic
951718041 3:25669991-25670013 TTGAAAACACAAAAGACTCAAGG - Intergenic
952469463 3:33630909-33630931 TGTAAAACACAAAAGGAGGAAGG + Intronic
952621368 3:35347171-35347193 AGGAATACACAAAAGAAACAAGG - Intergenic
954975314 3:54688449-54688471 ATGAATGAACAAATGAAGGAGGG + Intronic
955029373 3:55201424-55201446 TTGAATCCACAAATAAAGGGTGG - Intergenic
955035970 3:55268271-55268293 TTGAAAAAAAAAAAAAAGGATGG - Intergenic
956282537 3:67572949-67572971 ATGAATAAACAAGAAAAGGAAGG + Intronic
956696287 3:71921897-71921919 CTGAATACACATAGGAAGGTGGG - Intergenic
957134704 3:76271161-76271183 TTGAATACAAACAAAAAGTAGGG + Intronic
957334163 3:78805326-78805348 ATTAAGAAACAAAAGAAGGAGGG - Intronic
957355408 3:79078089-79078111 TTGAAACCACAAAGGAAAGAAGG + Intronic
957950736 3:87122771-87122793 TTAAAAAAACAAAATAAGGAAGG + Intergenic
957981061 3:87511180-87511202 TTGAAAACAAAATAAAAGGAAGG + Intergenic
958682173 3:97344907-97344929 ATGAAGGAACAAAAGAAGGAAGG + Intronic
958769044 3:98404310-98404332 TGGAAAACAGAAAAAAAGGAGGG + Intergenic
958791063 3:98651787-98651809 TGGAATACACAAAGGAAGGGAGG + Intergenic
958885698 3:99724384-99724406 ATTTATACACAAGAGAAGGACGG - Intronic
959176195 3:102914232-102914254 GTGAATACATAAAAGGAGGGAGG + Intergenic
959702590 3:109312024-109312046 TTTAAGACACAAAATAAGCATGG - Intronic
959938323 3:112053875-112053897 TGGAATACAAAAAAGAAGGGAGG - Intronic
959998846 3:112709309-112709331 TAGAAAACACAAAAAAAGCAGGG - Intergenic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
960562638 3:119102032-119102054 TAGAACAAACAAAAGATGGAAGG - Intronic
961761722 3:129174898-129174920 TAGAAAATACAAAACAAGGATGG + Intronic
961987384 3:131151943-131151965 TTGGATACACATTAGAGGGAAGG + Intronic
962993676 3:140603852-140603874 ATGAATACACAGAAGTAGAATGG + Intergenic
963573784 3:147033151-147033173 TTGAATTCATAAAAGAGGTAAGG + Intergenic
963802496 3:149690193-149690215 AGGAAGACAGAAAAGAAGGAAGG + Intronic
964116765 3:153144077-153144099 TTGAAATCACAAATGAAGTATGG - Intergenic
964251383 3:154721895-154721917 TTTATTACACAGAATAAGGAAGG - Intergenic
965174610 3:165315958-165315980 TTAAAGACACAAAAAATGGAAGG - Intergenic
965810332 3:172585167-172585189 GTGAATACCAAAAAGAAGAATGG - Intergenic
966652750 3:182319742-182319764 TGGAATACAGAAAAAAAGCAAGG - Intergenic
967246905 3:187496998-187497020 TAAAACAAACAAAAGAAGGAAGG + Intergenic
967382121 3:188870414-188870436 TTAAATACATAAATGAATGAGGG - Intronic
967830155 3:193911771-193911793 CTGAAGAGACAAAAGAAGGAGGG - Intergenic
969273202 4:6116787-6116809 ATGAATACATAAAACAATGATGG + Intronic
969340328 4:6536456-6536478 TTTAATCCACATAAGAAGAAAGG + Intronic
969545341 4:7822892-7822914 TTGAAAAAAAAAAAGAAAGAGGG - Intronic
970561104 4:17283141-17283163 TCGAATGCACAAAGGAAGAAGGG - Intergenic
970778988 4:19712698-19712720 TTGAAGAGAGAAAAGAAAGATGG - Intergenic
971834154 4:31740286-31740308 TTGATTAAACAAAAGAAAAATGG + Intergenic
973691312 4:53436118-53436140 TTGAATAGAGAAAAGATAGATGG + Intronic
973852495 4:54974931-54974953 TTGAATTTACAAAGGAAGGGAGG - Intergenic
973996487 4:56464377-56464399 GTGAATACACAAAAGTAGGAAGG + Intergenic
974207341 4:58723096-58723118 CTCAATACACAAAAGAAACAAGG + Intergenic
974484517 4:62489852-62489874 TTGAATACGAAAAAGAAAAAGGG - Intergenic
974756607 4:66217317-66217339 TTGAATGCACTAAAGGAAGATGG - Intergenic
974787502 4:66638701-66638723 TTGAATAGAAATAGGAAGGAAGG + Intergenic
975209230 4:71679684-71679706 GTGAACACACTTAAGAAGGAAGG + Intergenic
976380985 4:84398440-84398462 TTGGATACCCAAAAGAGGAATGG + Intergenic
976497405 4:85746309-85746331 TCAGATACTCAAAAGAAGGAGGG - Intronic
977124318 4:93145345-93145367 TTGACTAGATAAATGAAGGAGGG + Intronic
977219584 4:94323585-94323607 TGGAAAACAAAAAAAAAGGAGGG - Intronic
977471596 4:97450267-97450289 CAGAATAAATAAAAGAAGGAGGG - Intronic
977933754 4:102777493-102777515 TTAAAAAAAGAAAAGAAGGAAGG - Intergenic
977994695 4:103487076-103487098 TAGAACACACAAAAAAAGAAGGG + Intergenic
978130567 4:105191198-105191220 CTGAAAATACAAAAGAAAGAGGG + Intronic
978662234 4:111140722-111140744 TAGAGAACACAAAAGAAAGATGG + Intergenic
979407630 4:120332622-120332644 TTAAATAGAAAAAAGAAGGTAGG - Intergenic
979757519 4:124360606-124360628 TTAAAGAAACAAGAGAAGGAGGG + Intergenic
979829616 4:125283119-125283141 ATAAACAAACAAAAGAAGGATGG + Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
980734360 4:136866167-136866189 TTGAATATAAAAATGAAGAAAGG - Intergenic
982198852 4:152940066-152940088 GAGAATACACAAAAGAACGATGG - Intronic
982335206 4:154228857-154228879 TTGCAGAAACAAAAGAAGAAGGG - Intergenic
982481458 4:155916784-155916806 TTAAATACACAGAAGCATGACGG - Intronic
982929409 4:161383620-161383642 TTGAATACACAAGAAAAGAAGGG + Intergenic
982949359 4:161670184-161670206 TTGCATATACATATGAAGGAAGG + Intronic
982998626 4:162383197-162383219 ATGAATACACAAAGGTAGGGAGG + Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984346457 4:178533752-178533774 TTGAATACAAAAGAGAAGGCTGG + Intergenic
984436371 4:179715394-179715416 TTTAATACAGAAAAGAGGAAGGG - Intergenic
984437904 4:179727442-179727464 TTGAATTCCAAAAAGAAGGTAGG + Intergenic
985613438 5:903939-903961 TTGAGTACAAATAAGAAAGAGGG + Intronic
986612937 5:9588194-9588216 TTGCACACAAATAAGAAGGAAGG - Intergenic
987160235 5:15134059-15134081 TTGCATACAAAATAGAAGGGAGG - Intergenic
987183221 5:15387654-15387676 AAGGATACACAAAAGAGGGAAGG + Intergenic
987580863 5:19790338-19790360 TTAAATATATAAAGGAAGGAAGG - Intronic
987695275 5:21320565-21320587 CTAAATTAACAAAAGAAGGAAGG - Intergenic
987734399 5:21821256-21821278 TGCAATAAACAAAAAAAGGAAGG - Intronic
989079710 5:37605012-37605034 TTTAAAAAAAAAAAGAAGGAGGG - Intronic
989971354 5:50528391-50528413 TTGAATTCATAAATGATGGAAGG + Intergenic
990869160 5:60412569-60412591 GTGAATACACAAAACATGCAGGG - Intronic
990928554 5:61058605-61058627 TTAAACACACACAAAAAGGAAGG - Intronic
991923158 5:71677814-71677836 TTGAAGACATAAAAGATGCAAGG + Intergenic
992116854 5:73546880-73546902 TTGAAAAAAAAAAAGAATGAAGG - Intergenic
992127671 5:73658404-73658426 TTGAACACACCAGAGAAGAAGGG + Intronic
993232562 5:85255578-85255600 TTGAACAAACAAAAGAGGGAGGG - Intergenic
993313467 5:86368694-86368716 TTGAAAAGAAAAAAGAAGAAAGG + Intergenic
993597668 5:89879738-89879760 TTGAATACACTGAATCAGGATGG - Intergenic
993671578 5:90766904-90766926 TTTAATAATCAAAAGAAGGTGGG + Intronic
993845253 5:92934050-92934072 TTGAATACACTAAACAAAGTTGG - Intergenic
994294283 5:98070573-98070595 TTGAAAACACAACAGCAAGATGG - Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
995027997 5:107446877-107446899 ATAAATACACAAAGGAAGGGTGG + Intronic
995541279 5:113188547-113188569 TTCAAAACACAAAAGCAGAAAGG + Intronic
995865819 5:116689390-116689412 TTGAATACACAGAAAAAAAAAGG - Intergenic
996561361 5:124833079-124833101 TTGAAAACACAGAAAAAGGAAGG - Intergenic
997109563 5:131059917-131059939 TTGAGGACACAGAAAAAGGATGG - Intergenic
997576430 5:134981090-134981112 AAGAAGAAACAAAAGAAGGAAGG - Intronic
998434354 5:142094748-142094770 TTGAATACAAAAAATAAAGATGG - Intergenic
999040018 5:148398736-148398758 ATGAAAACTCAAAAGAAGAAAGG + Intronic
999353180 5:150897065-150897087 ATGAACTCACAAAAAAAGGATGG + Intronic
1000419863 5:161026409-161026431 ATGAAGTCACAAAAGTAGGAAGG + Intergenic
1000497151 5:161998844-161998866 AGGAATACACAAGAGAATGAAGG - Intergenic
1000841998 5:166231405-166231427 TTGAAAATACACAAGAAGGCCGG - Intergenic
1001564922 5:172693773-172693795 TTGAATAAAGAAAAAAAGGTAGG + Intergenic
1001803900 5:174567104-174567126 TTGAAGACACAAAGGCTGGAGGG + Intergenic
1003214583 6:4097746-4097768 TGGAACACCCAAAAGAAGGAAGG + Intronic
1003302218 6:4893847-4893869 TTGAATGCACCAAAGCAGGACGG - Intronic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1004869895 6:19894289-19894311 TTGTAGACACATCAGAAGGAAGG + Intergenic
1005860039 6:29893307-29893329 TTGCATCCTCAACAGAAGGAAGG + Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006593924 6:35179054-35179076 TGGGACACATAAAAGAAGGAAGG + Intergenic
1007962916 6:45977432-45977454 TTTAATTTACAAAAGATGGAGGG - Intronic
1008673441 6:53795521-53795543 GTGAATGCATAAAAGAGGGAAGG - Intronic
1009511568 6:64556490-64556512 TTGACTACACAAAGGCATGAGGG + Intronic
1010809475 6:80283273-80283295 TTCAATACCAAAAAGAGGGATGG - Intronic
1010970960 6:82262968-82262990 TCGAAAAAAAAAAAGAAGGAAGG + Intergenic
1011038036 6:82999339-82999361 TTGATTACACATGAGAAAGAAGG - Intronic
1011583328 6:88896754-88896776 TTCAATACACAAAGGATAGAGGG - Intronic
1011642921 6:89432506-89432528 TTGAATACATGTAAGATGGATGG - Intergenic
1011888225 6:92124679-92124701 TTGAATACATAAAAGCAGACAGG + Intergenic
1011973052 6:93253077-93253099 TTGAATCCAATACAGAAGGAAGG + Intronic
1012519878 6:100108792-100108814 TTAAATACAAAAAAGAAGGGAGG + Intergenic
1012603330 6:101126177-101126199 GTGAATAGAAGAAAGAAGGAAGG - Intergenic
1013732837 6:113189271-113189293 TTGAATAAACCAAAGTAGAATGG - Intergenic
1013989138 6:116233337-116233359 ATGAATGAAGAAAAGAAGGAGGG - Intronic
1014491349 6:122065547-122065569 TTGAATAAATATACGAAGGAAGG + Intergenic
1014933384 6:127359898-127359920 TTGAATAAAGAAAATAAGGCCGG - Intergenic
1015245420 6:131068860-131068882 TTAAAAAAAGAAAAGAAGGAAGG - Intergenic
1015895921 6:138016705-138016727 TTGAACAAACAAAAAATGGATGG - Intergenic
1016051711 6:139536939-139536961 TTGAACACACAATGGAAGCAAGG - Intergenic
1017114326 6:150962742-150962764 TTCAAAACACTAAAGGAGGAAGG - Intronic
1017157110 6:151332375-151332397 CTGAATATACCCAAGAAGGAGGG - Intronic
1017395416 6:153993264-153993286 TTGAATGTACAAAAGGAGGAAGG - Intergenic
1018002254 6:159589683-159589705 TTGAATAAACAAAATAAAAATGG + Intergenic
1019321618 7:418342-418364 TTGATTACACCAAAGAAGGCAGG - Intergenic
1019402819 7:866326-866348 TGGAACACCCAAAAGAGGGAGGG - Intronic
1020190226 7:5990457-5990479 TTGAATAGACAAAATACGGAAGG + Intronic
1020600190 7:10265516-10265538 TTGAACACACAAAGGTAAGAGGG - Intergenic
1020713845 7:11644078-11644100 CACAATACACAAAAGAATGAAGG - Intronic
1020864077 7:13534026-13534048 ATGAAAACACCAAAGAAAGAGGG - Intergenic
1021051933 7:15996444-15996466 TTGAATACACAAAAAAACTCTGG + Intergenic
1021225405 7:18020629-18020651 ATGAATAGGCAAAAGAAGGTTGG - Intergenic
1022718363 7:32919606-32919628 TTGAAAAAAAAAAAAAAGGATGG + Intergenic
1023372176 7:39522576-39522598 TTCAAAAAAAAAAAGAAGGAAGG + Intergenic
1023468511 7:40486719-40486741 TTGAAAAAAAAAAAAAAGGAAGG - Intronic
1024117600 7:46208613-46208635 TTGATTAGACACAAGAGGGAAGG - Intergenic
1024332831 7:48173410-48173432 TTGAATAAGTAAAAGAAGGAAGG + Intronic
1024809104 7:53186522-53186544 TTGAATACAGAAAACAATAAAGG + Intergenic
1026333078 7:69370121-69370143 TTGAATGAATAAATGAAGGAAGG - Intergenic
1027482493 7:78716489-78716511 GGGAATACAAAAAAGAAGAAAGG + Intronic
1027507644 7:79037794-79037816 TGGAAGACAAAAAAGAAGTAAGG - Intronic
1028280329 7:88917727-88917749 TATAATACACAAAAGAGGGATGG + Intronic
1028962574 7:96765912-96765934 TTGTATAAACAAAAGAAAAAAGG - Intergenic
1029594335 7:101528843-101528865 TTTAAAAAAGAAAAGAAGGATGG - Intronic
1030249257 7:107424110-107424132 TTGAATACAAAAAATTAGCAGGG + Intronic
1030364745 7:108632577-108632599 TAGAAAAGACAATAGAAGGAAGG + Intergenic
1030684111 7:112466244-112466266 TTAAAAACACAAAAAAAGGAAGG - Intronic
1030697892 7:112605902-112605924 TTTAAAATACAAAAGATGGATGG - Intergenic
1030841824 7:114363137-114363159 ATGAATACAGAATAGAAGAATGG - Intronic
1030942545 7:115671607-115671629 TTTAAAAGACAGAAGAAGGACGG - Intergenic
1033487321 7:141803827-141803849 TTGAATTCATAAAAGCAGGGTGG + Intergenic
1035215327 7:157362060-157362082 TTAAATACAAAAAAAAAGGCCGG - Intronic
1035278888 7:157765154-157765176 TTGGATGGATAAAAGAAGGATGG - Intronic
1036934313 8:12986315-12986337 TGGAGAACAGAAAAGAAGGATGG - Intronic
1037024637 8:14019414-14019436 TTGAAGACAAAAAATAAGCAAGG + Intergenic
1038043768 8:23749020-23749042 TTAAATACACAAATGCAGGAGGG + Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038557032 8:28528912-28528934 ATAAATACATAAAAGAAGGTAGG - Intronic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1041362157 8:57065811-57065833 TGGGGTACACAAAAGAAGGAGGG - Intergenic
1041577481 8:59416022-59416044 TTGAATATATAAATGAAGCAGGG - Intergenic
1041602982 8:59744134-59744156 TTGAATCCACTAATGAAGAATGG + Intergenic
1041768134 8:61441994-61442016 CTTGATATACAAAAGAAGGATGG - Intronic
1042817149 8:72890073-72890095 TTGGAAAGAAAAAAGAAGGATGG + Intronic
1043728841 8:83649618-83649640 TTGAATGAAAGAAAGAAGGAGGG - Intergenic
1043998635 8:86850284-86850306 TTGAAAACATAAAAGAAGAGAGG + Intergenic
1044404073 8:91807290-91807312 TTAAAAAGAGAAAAGAAGGAAGG + Intergenic
1044547379 8:93474814-93474836 ATGAATACACAAAAGGTGCAAGG - Intergenic
1044665422 8:94629829-94629851 TTCAATTCATGAAAGAAGGAAGG + Intergenic
1044988060 8:97772570-97772592 GTGAAAACACAAAACAAGGCTGG + Intergenic
1045756064 8:105543736-105543758 TTGAATACACAAAAGAAGGAAGG - Intronic
1046324075 8:112617551-112617573 TGGAATAAACAACAGAAGAAAGG - Intronic
1046345969 8:112927473-112927495 TTGAATATTCAAGAGAAAGAAGG - Intronic
1046391554 8:113579264-113579286 TTAAATACACAGAATAGGGATGG + Intergenic
1046577670 8:116051326-116051348 GGGAATGCACAAAGGAAGGAGGG - Intergenic
1046630705 8:116620252-116620274 TTGAAAACACAAAAGATCAATGG + Intergenic
1046751585 8:117932607-117932629 TTGAATAGAAAAAAGAGGGGTGG - Intronic
1046916293 8:119681452-119681474 GTTATTACACAAATGAAGGAAGG + Intergenic
1047360485 8:124164515-124164537 TTGAATTAACAAAGGGAGGAGGG - Intergenic
1047536628 8:125726149-125726171 TTGAATAAACATGAAAAGGAAGG - Intergenic
1047981027 8:130182310-130182332 TTGAAGACAAAAAAGGATGACGG + Intronic
1048003180 8:130396444-130396466 TTAAATACATAAAGGAAGGAAGG - Intronic
1048053871 8:130845830-130845852 TTGAATTAATAAAAGAAGGAAGG + Intronic
1048250942 8:132866457-132866479 TAGAAGAAAGAAAAGAAGGAAGG + Intergenic
1050181649 9:2929180-2929202 TTGAAAAAAGAGAAGAAGGAAGG + Intergenic
1050820942 9:9879191-9879213 TAGAATAAACAAAAGAAAAAAGG - Intronic
1051660590 9:19422733-19422755 TTAAAAACACAAAAGCAGGCGGG + Intronic
1052154245 9:25164998-25165020 TTGAATACTCAGAATAAGTAGGG - Intergenic
1052172699 9:25421161-25421183 TAGAATACACATATGATGGATGG - Intergenic
1052498017 9:29253153-29253175 TTGAATACATAAATTAATGAAGG - Intergenic
1053228980 9:36389310-36389332 TTGAAAACACAAAGGGAGTATGG + Intronic
1053683640 9:40501447-40501469 CTGATTACACCAAAGTAGGAGGG - Intergenic
1053698442 9:40661851-40661873 ATGAACACAAGAAAGAAGGAAGG - Intergenic
1053933621 9:43129764-43129786 CTGATTACACCAAAGTAGGAGGG - Intergenic
1054280075 9:63123474-63123496 CTGATTACACCAAAGTAGGAGGG + Intergenic
1054296742 9:63336944-63336966 CTGATTACACCAAAGTAGGAGGG - Intergenic
1054309733 9:63461264-63461286 ATGAACACAAGAAAGAAGGAAGG - Intergenic
1054394759 9:64641450-64641472 CTGATTACACCAAAGTAGGAGGG - Intergenic
1054429407 9:65146650-65146672 CTGATTACACCAAAGTAGGAGGG - Intergenic
1054500975 9:65874881-65874903 CTGATTACACCAAAGTAGGAGGG + Intergenic
1054727348 9:68665733-68665755 TTGAAGAAACAAATGAATGATGG - Intergenic
1056409761 9:86313343-86313365 GGGAATACACAGAAGAAGCAAGG + Intronic
1056723642 9:89092718-89092740 TTTCTAACACAAAAGAAGGAAGG + Intronic
1056902004 9:90608586-90608608 TTGAAGACCCCACAGAAGGACGG + Intergenic
1057143692 9:92744270-92744292 GTGAACACACAAAAAAAGTACGG + Intronic
1057350017 9:94288439-94288461 TTGAAAACAAAAGAGAAGAATGG - Intronic
1057602735 9:96472633-96472655 ATGAATATACCAAAAAAGGAAGG - Intronic
1057905447 9:98979522-98979544 ATGAATACCCAAAAGAAAAATGG - Intronic
1058533972 9:105935725-105935747 TTTAATACAGAAAAGAACAAAGG + Intergenic
1058675680 9:107398280-107398302 TTGACTATACAAAAACAGGATGG + Intergenic
1058822265 9:108743700-108743722 AAGAATACACAAAAGAGGAAAGG + Intergenic
1059072036 9:111147907-111147929 TTGCATAAACAAAAAGAGGATGG + Intergenic
1059187356 9:112286679-112286701 TTAAATTAACAAAAAAAGGAGGG + Intronic
1060045494 9:120337026-120337048 TGGAAGAAAGAAAAGAAGGACGG + Intergenic
1060491099 9:124084886-124084908 TGGAATGCAGAAGAGAAGGAGGG + Intergenic
1061302028 9:129710892-129710914 GTGAAGACAGAAAAGAAGGAAGG - Intronic
1202780805 9_KI270717v1_random:35056-35078 ATGAACACAAGAAAGAAGGAAGG - Intergenic
1185721593 X:2386791-2386813 TTCCACACACAAAAGAAGCAAGG - Intronic
1186369040 X:8927750-8927772 TTAAATAAATAAAAGAAAGAGGG - Intergenic
1187215336 X:17270427-17270449 TTAAATACATACAAGAAAGATGG + Intergenic
1187230629 X:17418973-17418995 ATACATACACAAGAGAAGGAAGG - Intronic
1187536144 X:20143029-20143051 TTCAATACACACAGAAAGGAAGG + Intergenic
1187777620 X:22780274-22780296 TGGAATAAAGAAAAGAAAGAGGG + Intergenic
1188027380 X:25224341-25224363 GTGATTAGACAAAAGAAAGAAGG - Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188549753 X:31350085-31350107 TTATATACACAAAAGCATGAGGG + Intronic
1189301303 X:39954510-39954532 ATGAATGAACAAATGAAGGAAGG + Intergenic
1189716803 X:43875433-43875455 TTGAATATTCAAAATCAGGAAGG + Intronic
1190278729 X:48915633-48915655 TTGAATAAACGAAAGAAGTTCGG + Intronic
1192113269 X:68386885-68386907 TTTTATAAACCAAAGAAGGAAGG + Intronic
1192549532 X:72042866-72042888 TTGAATAAATAAATGAAGGAAGG + Intergenic
1192620947 X:72679828-72679850 TTGAATACTCGAAGGAAGGGGGG + Intronic
1192632984 X:72791337-72791359 TAGAAAACAGAAGAGAAGGAGGG + Intronic
1192648725 X:72929464-72929486 TAGAAAACAGAAGAGAAGGAGGG - Intronic
1193239095 X:79144865-79144887 ATGAATACAGGAGAGAAGGAGGG - Intergenic
1193294352 X:79817070-79817092 TAGAAAACAGAAAATAAGGAGGG - Intergenic
1193761716 X:85475308-85475330 TAGAATAGACAAAGGAAGTATGG + Intergenic
1193784198 X:85739127-85739149 TTGAATAAACAAAGGAGAGAAGG + Intergenic
1194052184 X:89083019-89083041 TTGAAGAAATAAAAGAATGATGG + Intergenic
1194363776 X:92988654-92988676 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1195370837 X:104170666-104170688 TTGAAAATATAAAAGAAGGTGGG + Intronic
1195391977 X:104371816-104371838 TTGAAGATACAAGTGAAGGATGG - Intergenic
1195462693 X:105145432-105145454 TTGAGTACACAGAAGGAGGCAGG + Intronic
1195733494 X:107989900-107989922 TGGAAAACAAAAAAGAAGGCAGG - Intergenic
1196199745 X:112872102-112872124 CTGTTTACACAAAAGGAGGAGGG - Intergenic
1196432627 X:115643159-115643181 TTGAATGCAAAAAAAAAGGTTGG - Intronic
1196659608 X:118256150-118256172 TTCAATATACATAAGAAAGAAGG + Intergenic
1196818109 X:119681118-119681140 TTAAATACGCAAAGGTAGGAAGG + Intronic
1197140251 X:123109992-123110014 TGGAAAAATCAAAAGAAGGAAGG - Intergenic
1197803999 X:130382026-130382048 TTAAGTACAGAAAAGCAGGAGGG - Intergenic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1198619842 X:138494528-138494550 TTGATGTCATAAAAGAAGGAGGG - Intergenic
1199313424 X:146348185-146348207 TTGAATATGCAAAAGAGAGAAGG + Intergenic
1199723033 X:150556810-150556832 ATGAATAAACAAAAGATGGTAGG + Intergenic
1200023274 X:153230028-153230050 TTGAAAATACAAAAGGAAGAAGG - Intergenic
1200672008 Y:6104893-6104915 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1201517700 Y:14835664-14835686 ATGGAGACAAAAAAGAAGGAAGG + Intronic
1201570498 Y:15408422-15408444 TGGAAAACAAAAAAAAAGGAAGG + Intergenic
1201970207 Y:19784353-19784375 TTGAATACACAACAAAATTAAGG + Intergenic