ID: 1045758702

View in Genome Browser
Species Human (GRCh38)
Location 8:105576147-105576169
Sequence TACCGTGTGCTGTAAGATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045758702_1045758704 23 Left 1045758702 8:105576147-105576169 CCACTATCTTACAGCACACGGTA 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1045758704 8:105576193-105576215 GTAAACATGGTCAAGAAAAGTGG No data
1045758702_1045758703 10 Left 1045758702 8:105576147-105576169 CCACTATCTTACAGCACACGGTA 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1045758703 8:105576180-105576202 CGCAGAGCAATTAGTAAACATGG No data
1045758702_1045758705 24 Left 1045758702 8:105576147-105576169 CCACTATCTTACAGCACACGGTA 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1045758705 8:105576194-105576216 TAAACATGGTCAAGAAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045758702 Original CRISPR TACCGTGTGCTGTAAGATAG TGG (reversed) Intronic
901176302 1:7301918-7301940 TTCCGTGTGCTGGATGACAGGGG - Intronic
908440442 1:64148380-64148402 TACAGTGAGTTGTAAGCTAGTGG + Intronic
910169409 1:84361454-84361476 TACCCTGTGCTGTGAGGTAGGGG + Intronic
915918874 1:159959417-159959439 TCCTGGGTGCTGTACGATAGGGG - Intergenic
916877922 1:168989854-168989876 TAGTGTGTGGTGTAAGAGAGGGG - Intergenic
917585744 1:176425225-176425247 TATAGTGTGCTGTAAGCTTGGGG + Intergenic
1067366358 10:45633105-45633127 TACTTTTTGCTGTAAGAAAGTGG - Intronic
1077381060 11:2237830-2237852 TGGCGTGTGGTGTTAGATAGGGG + Intergenic
1083512180 11:63220109-63220131 TACCTTTTGTTGTAAGGTAGAGG + Intronic
1088403450 11:109445969-109445991 TACCATGTGTGGTGAGATAGGGG + Intergenic
1091637813 12:2211263-2211285 TACTGTGAGGTGTAAGAAAGTGG - Intronic
1095813626 12:46397803-46397825 TGCCGAGTGCTTTAAGAAAGAGG + Intergenic
1104302044 12:127573068-127573090 TACTGTGTGGTCTAAGATACAGG + Intergenic
1106755397 13:32817986-32818008 TTGTGTGTGTTGTAAGATAGAGG - Intergenic
1111147913 13:84208870-84208892 TTCCATGTACTGTAAGATTGAGG + Intergenic
1111675386 13:91380871-91380893 TACCAGGGGCTGAAAGATAGAGG - Intergenic
1116421290 14:44735741-44735763 TACTGGGTGCTGTAAGACAATGG - Intergenic
1116565107 14:46434933-46434955 TACAGTAAGCTGAAAGATAGAGG + Intergenic
1119797774 14:77414776-77414798 TACAGTATGCTGTATAATAGTGG - Intronic
1121343646 14:93119494-93119516 TACCTTATGAAGTAAGATAGAGG - Intergenic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1124230130 15:27937546-27937568 TACTGAGTGCTGAAAGATTGTGG - Intronic
1127679859 15:61282958-61282980 TACTGTGTGCCGTAAGCTGGTGG + Intergenic
1159085423 18:63784173-63784195 TACTGTGTGCTGGTAGATGGCGG + Intronic
927945676 2:27133901-27133923 CACCCTGTTCTGTAAAATAGAGG - Intronic
928787058 2:34900852-34900874 TATCTTGTGGTGTAAGAAAGTGG - Intergenic
929093545 2:38242916-38242938 TACCCTGTGCTGTGAGATCCTGG - Intergenic
933105058 2:78314080-78314102 TTCTGTGTGGTGTAAGATAGAGG - Intergenic
935365257 2:102282642-102282664 TGCTATTTGCTGTAAGATAGGGG - Intergenic
936707653 2:115094460-115094482 TACCATGTGATGTAAGTTAGAGG - Intronic
937492106 2:122380632-122380654 GACGGTGTTCTATAAGATAGAGG + Intergenic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
963902483 3:150745853-150745875 TTCTGTGTGCTCTAGGATAGAGG - Intronic
977256070 4:94741426-94741448 CACTGTGTGTTGTAAGATAAGGG + Intergenic
977470181 4:97433612-97433634 TACCATGGGCTGCAAGAGAGAGG + Intronic
979011098 4:115369955-115369977 TACTGTGTGCAGTAAAATACTGG + Intergenic
989711347 5:44401063-44401085 TACTGTTTGCTGTAAAATATTGG - Intergenic
991337819 5:65569472-65569494 TGCAGTGTTCTGTAATATAGTGG + Intronic
1002682120 5:180974382-180974404 TTGTGTGTGGTGTAAGATAGGGG - Intergenic
1006720666 6:36147992-36148014 TACCTGGTGCTGTAAGCAAGAGG - Intergenic
1009697445 6:67125621-67125643 TTCTGTGTGCTGTAGGATTGAGG + Intergenic
1016722583 6:147319641-147319663 TAGCGTTTGGTGTCAGATAGAGG + Intronic
1017732710 6:157331877-157331899 TACCATGAGCTGCAAGAGAGAGG - Intergenic
1020791071 7:12628691-12628713 TTCCCTGTGCTTTAAGATAGCGG - Intronic
1026326362 7:69314171-69314193 TACCTTGTGCTGTGAGACAGGGG - Intergenic
1028774967 7:94665659-94665681 TACAGGGTACTGTAAGATGGAGG - Exonic
1028895095 7:96032015-96032037 TACCGTTTGCAGTAGTATAGAGG - Intronic
1031509267 7:122628037-122628059 TACAGTGTGCTATAAATTAGGGG - Intronic
1038329734 8:26598637-26598659 TACTTTGTGCTGTAAGCTAACGG - Intronic
1039933493 8:42017632-42017654 TACAGTGTGCTGGAAGGCAGAGG + Intronic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1050726211 9:8652100-8652122 TACCCTGAGCTGTAAATTAGAGG - Intronic
1056155049 9:83825910-83825932 TACCATGTTATGTAAGATAGGGG - Intronic
1057021615 9:91702627-91702649 TTGTGTGTGATGTAAGATAGGGG + Intronic
1195485665 X:105403016-105403038 TAAAGTGTGCTGCAACATAGTGG + Intronic
1198010367 X:132546375-132546397 TACTGTGAGCAGAAAGATAGAGG - Intergenic
1200271184 X:154685882-154685904 TTGTGTGTGCTGTGAGATAGGGG - Intronic