ID: 1045758703

View in Genome Browser
Species Human (GRCh38)
Location 8:105576180-105576202
Sequence CGCAGAGCAATTAGTAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045758702_1045758703 10 Left 1045758702 8:105576147-105576169 CCACTATCTTACAGCACACGGTA 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1045758703 8:105576180-105576202 CGCAGAGCAATTAGTAAACATGG No data
1045758700_1045758703 24 Left 1045758700 8:105576133-105576155 CCAGCAAAATAGAACCACTATCT 0: 1
1: 0
2: 3
3: 14
4: 202
Right 1045758703 8:105576180-105576202 CGCAGAGCAATTAGTAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045758703 Original CRISPR CGCAGAGCAATTAGTAAACA TGG Intronic
No off target data available for this crispr