ID: 1045760175

View in Genome Browser
Species Human (GRCh38)
Location 8:105596425-105596447
Sequence CAGGGTAAAAACTAGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045760175_1045760182 5 Left 1045760175 8:105596425-105596447 CCACCATCCTAGTTTTTACCCTG 0: 1
1: 0
2: 0
3: 23
4: 197
Right 1045760182 8:105596453-105596475 AAATAGATTGGCACTCTCCCTGG No data
1045760175_1045760179 -7 Left 1045760175 8:105596425-105596447 CCACCATCCTAGTTTTTACCCTG 0: 1
1: 0
2: 0
3: 23
4: 197
Right 1045760179 8:105596441-105596463 TACCCTGGTTGCAAATAGATTGG No data
1045760175_1045760187 30 Left 1045760175 8:105596425-105596447 CCACCATCCTAGTTTTTACCCTG 0: 1
1: 0
2: 0
3: 23
4: 197
Right 1045760187 8:105596478-105596500 GTTCTGGTATGCCATACCTAGGG No data
1045760175_1045760183 14 Left 1045760175 8:105596425-105596447 CCACCATCCTAGTTTTTACCCTG 0: 1
1: 0
2: 0
3: 23
4: 197
Right 1045760183 8:105596462-105596484 GGCACTCTCCCTGGTTGTTCTGG No data
1045760175_1045760186 29 Left 1045760175 8:105596425-105596447 CCACCATCCTAGTTTTTACCCTG 0: 1
1: 0
2: 0
3: 23
4: 197
Right 1045760186 8:105596477-105596499 TGTTCTGGTATGCCATACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045760175 Original CRISPR CAGGGTAAAAACTAGGATGG TGG (reversed) Intronic
903516081 1:23911906-23911928 CAGCATGAAAACCAGGATGGAGG - Intronic
903728563 1:25471644-25471666 CAGGGAAAATACTAGGAAGCAGG + Intronic
904042155 1:27591247-27591269 CAGGGAGGAAACTAGGCTGGTGG + Intronic
905944065 1:41887198-41887220 CAGGGAAAAAAGTATTATGGAGG + Intronic
906526517 1:46496378-46496400 CAGGGTACTTACTGGGATGGGGG + Intergenic
907164388 1:52397652-52397674 CAAGGTAGAACCAAGGATGGTGG + Intronic
908280196 1:62525422-62525444 CAGGTCAAAAACAAGGATGTTGG - Intronic
911779814 1:101861966-101861988 CAGGGTTAAAAATAGGATTGGGG + Intronic
913329097 1:117652627-117652649 CAGGGGTGAAACTAGGATGAAGG - Intergenic
915248551 1:154572543-154572565 CAGGTTAACAACTTGGATGTGGG - Intronic
918200302 1:182260074-182260096 CAGGGAAAGAACTGGGATGTTGG - Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
922447008 1:225706224-225706246 GAGGGTGAAAACAATGATGGAGG + Intergenic
922465346 1:225842679-225842701 CATGGTCAAGACTAGGATGCAGG + Intronic
1062834384 10:626418-626440 GAGGGTAACACCGAGGATGGGGG - Intronic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1066092055 10:32032492-32032514 CAGGGTGAAAAAAAAGATGGCGG + Intronic
1066798598 10:39156202-39156224 CAGGATAAAAACTAGAAAGAAGG + Intergenic
1068873691 10:61973606-61973628 CAGTGTAAAAAATGGGAGGGGGG + Intronic
1072449894 10:95531578-95531600 CAGGGGCAAAACAAGGCTGGTGG + Intronic
1072616133 10:97049845-97049867 CAGGATAAATACGGGGATGGTGG + Intronic
1072754894 10:98012789-98012811 CAGGGCAGAAACTGGGAAGGAGG + Intronic
1075886515 10:125904079-125904101 CAGAAGAAAAACTAGGATAGTGG - Intronic
1077916551 11:6615394-6615416 CAGGGTAAGAGTGAGGATGGGGG - Intronic
1079469963 11:20768827-20768849 CAGGACAAAAACCAAGATGGGGG - Intronic
1082294690 11:50425329-50425351 CAGGGTAAAAACTGGAAGGAAGG + Intergenic
1082295348 11:50435112-50435134 CAGGATAAAAACTAGAAGGATGG + Intergenic
1082309310 11:50627277-50627299 CAGGATAAAAACTAGGAGTAAGG + Intergenic
1082584649 11:54920925-54920947 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1082592143 11:55025159-55025181 CAGGTTAAAAACTAGAAGGAAGG - Intergenic
1082592180 11:55025671-55025693 CAGGTTAAAAACTAGAAGGAAGG - Intergenic
1082592910 11:55036263-55036285 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1082595425 11:55074047-55074069 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1082806279 11:57453601-57453623 GTGGGTAAAGTCTAGGATGGAGG - Intergenic
1087136560 11:94726673-94726695 CAGGGTTTAGACTTGGATGGAGG + Intronic
1094559898 12:31542363-31542385 AAGGGTAGAAGGTAGGATGGGGG + Intronic
1094860223 12:34456987-34457009 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1094860727 12:34463054-34463076 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1094864583 12:34515724-34515746 CAGGATAAAAACTAGCAGGAAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097729366 12:63110113-63110135 CAAGGTAACAACTAGCCTGGTGG + Intergenic
1098070169 12:66665479-66665501 GAGGGTAGAAGTTAGGATGGTGG - Intronic
1099988504 12:89697760-89697782 CAGAGTAGAAAATGGGATGGGGG - Intronic
1103013391 12:117475331-117475353 CAGGAAAAAAATTAGGCTGGGGG - Intronic
1105396815 13:20043933-20043955 CAGGGTAGAAGCTATGATGGGGG + Intronic
1107829191 13:44359415-44359437 GAGGGTGAAAAGTAGGAGGGAGG - Intergenic
1107916295 13:45155178-45155200 CAAGGTTAAAACTAGGGTAGTGG - Intronic
1111093520 13:83478354-83478376 CTGGGTACAAACCAAGATGGTGG - Intergenic
1115307047 14:31944308-31944330 CATGGTAAACACTTGGAGGGAGG - Intergenic
1115611425 14:35052139-35052161 ATGGGTAGAAACTAAGATGGGGG - Intronic
1115700927 14:35952243-35952265 CAGGGAAAAACATAGGCTGGTGG + Intergenic
1116660493 14:47704467-47704489 CAGGGGAGAAAAGAGGATGGGGG + Intergenic
1119182698 14:72615171-72615193 CAGGCTAAAAACCAGCCTGGGGG + Intergenic
1121092329 14:91191257-91191279 CAGGGCAGAAAGTAGAATGGTGG + Intronic
1202871571 14_GL000225v1_random:169856-169878 CAGAAGAAAAACTAGGATAGTGG + Intergenic
1127687925 15:61366550-61366572 CAGGGTGAAGACTAGGATGAGGG + Intergenic
1127723096 15:61721903-61721925 CAGGAGAGAAACTAGGAAGGTGG + Intergenic
1130219529 15:82007562-82007584 GAGGGTGAGAACTAGGATGGTGG - Intergenic
1130244975 15:82238848-82238870 AAGGTTACAAACTAGGATTGTGG - Intronic
1130455652 15:84104256-84104278 AAGGTTACAAACTAGGATTGTGG + Intergenic
1130765735 15:86869204-86869226 CAGGGGAAAAGCTAGCATGGAGG + Intronic
1130789382 15:87136214-87136236 CAAGGGCAAAACTTGGATGGCGG - Intergenic
1131213880 15:90520904-90520926 CAGGGCAAAAGCTGGGATGGAGG + Intergenic
1133290352 16:4716567-4716589 CAGAGTCAAAAGTAGGATGGGGG - Intronic
1134247928 16:12553744-12553766 AAGGAAAAAAACTAGGCTGGGGG - Intronic
1134776506 16:16858295-16858317 CAGGGAAGAAACTGGGAGGGTGG - Intergenic
1135073344 16:19371505-19371527 CAGGGTAAAAATCAGGATTCAGG + Intergenic
1136739838 16:32508185-32508207 CAGTGTAAAAACTAGAAGGAAGG - Intergenic
1136740788 16:32523144-32523166 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1203012479 16_KI270728v1_random:310158-310180 CAGGATAAAAACTAGTAGGAAGG + Intergenic
1203013073 16_KI270728v1_random:319152-319174 CAGTGTAAAAACTAGAAGGAAGG + Intergenic
1203013448 16_KI270728v1_random:324375-324397 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1203028814 16_KI270728v1_random:552089-552111 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1203030814 16_KI270728v1_random:583317-583339 CAGGATAAAAACTAGTAGGAAGG + Intergenic
1203031408 16_KI270728v1_random:592311-592333 CAGTGTAAAAACTAGAAGGAAGG + Intergenic
1203031783 16_KI270728v1_random:597534-597556 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1203039938 16_KI270728v1_random:736897-736919 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1203040313 16_KI270728v1_random:742120-742142 CAGTGTAAAAACTAGAAGGAAGG - Intergenic
1203040907 16_KI270728v1_random:751114-751136 CAGGATAAAAACTAGTAGGAAGG - Intergenic
1203042907 16_KI270728v1_random:782342-782364 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1142732137 17:1866759-1866781 CAGTGTAAAAACTAAAACGGTGG - Intronic
1143002026 17:3800575-3800597 CAGGGTAAAAACTGGAATGTGGG - Intronic
1143902003 17:10181430-10181452 AAGGGTAAAGAAGAGGATGGGGG + Intronic
1144460773 17:15457102-15457124 CTGGGTAAAAATGAGGATTGAGG + Intronic
1146625190 17:34430060-34430082 CAGAGTAGAAACTCGGACGGTGG + Intergenic
1146841182 17:36155368-36155390 CAGGGGAAAAAAAAGGGTGGGGG + Intergenic
1147939281 17:44034463-44034485 CAGGGTATAATTTAAGATGGGGG - Intergenic
1150394648 17:64811690-64811712 CAGCGTTATAGCTAGGATGGGGG + Intergenic
1150927354 17:69546932-69546954 CAGAGTAAAATCTAGGAAGAAGG + Intergenic
1153843329 18:9026656-9026678 CAAAGTAAAAACTAGAATAGAGG + Intergenic
1155056503 18:22188422-22188444 CAGGGGAAAAATTGGGATAGAGG + Intronic
1156884708 18:42121653-42121675 CAGGGTAAAAAGTAGATTGGAGG - Intergenic
1158422511 18:57307954-57307976 CATGGTAGAAAATAGCATGGAGG + Intergenic
1158664658 18:59421480-59421502 AAGGGTAAAAACCAGAATAGGGG + Intergenic
1159884123 18:73888102-73888124 CAGGGTGAAAGCTAGAGTGGAGG - Intergenic
1161927627 19:7312986-7313008 CCGGGTAAAGACTGGGAAGGCGG - Intergenic
1162985830 19:14268983-14269005 CAGGGGAAAAAGTAGGGTGGGGG - Intergenic
1163565426 19:18048410-18048432 CAGGGTCAAGGCTAGGCTGGAGG + Intergenic
1165988266 19:39789712-39789734 CAGGGGAAAGAATGGGATGGAGG + Intergenic
1166288774 19:41848559-41848581 CTGGGTAGGAACTAGGGTGGGGG - Intronic
1168404106 19:56101994-56102016 CGGGGTAGAAACTATGATGGGGG - Intronic
927324009 2:21782030-21782052 CATGGAAAAGACTGGGATGGAGG + Intergenic
929095586 2:38260638-38260660 CAGGGGGAAACCCAGGATGGTGG - Intergenic
930136685 2:47909096-47909118 CAGGGTGGAAACTAGAATTGAGG - Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932451858 2:71815858-71815880 CAGGCTCAAAACTATGCTGGGGG + Intergenic
932778607 2:74545240-74545262 GAGGGTAAAAACAAAGATGGAGG - Intronic
933408706 2:81897011-81897033 CAGGATAAATACCAGGATGTAGG - Intergenic
933461214 2:82588170-82588192 CATGGTGAAAACTAGAATTGAGG + Intergenic
933646217 2:84814727-84814749 CATGGTATGAACTAGGGTGGAGG - Intronic
935284378 2:101551012-101551034 ACTGATAAAAACTAGGATGGAGG - Intergenic
937320959 2:120960460-120960482 TAAGGTAAAAACTGGGCTGGTGG - Intronic
942681069 2:178478973-178478995 GAGCGTAAAAAATAGGCTGGCGG + Intergenic
943958399 2:194224359-194224381 CAAAGTACAAACTATGATGGAGG - Intergenic
944021950 2:195115460-195115482 CAAGGTAGAAACCAGGTTGGAGG + Intergenic
1169212494 20:3775079-3775101 AAGGATGAAATCTAGGATGGTGG + Intergenic
1170633253 20:18083160-18083182 GAGGGTGGAGACTAGGATGGTGG - Intergenic
1177112136 21:17041431-17041453 CAGGGTAAAGTGTAGGAGGGGGG - Intergenic
1177718355 21:24870378-24870400 AAGGGTAAAAAATAGGATCGTGG + Intergenic
1178286688 21:31331413-31331435 CAGGGGAAAAATGAGGAAGGAGG + Intronic
1179001379 21:37462751-37462773 CAGGGTACAATATAGGAAGGGGG - Intronic
1180652622 22:17391262-17391284 CAGTGTGTAAACCAGGATGGAGG - Intronic
949488311 3:4563096-4563118 AAGGGTAAAAGCTATGATGTAGG + Intronic
950541396 3:13615345-13615367 CAGCGAAAAAACTGGGCTGGTGG - Intronic
951050132 3:18084753-18084775 CAGGGTAAAATGTTGGAGGGAGG + Intronic
951974419 3:28488226-28488248 CAGGGTGGAAACTAGTATAGGGG - Intronic
953529354 3:43726162-43726184 CAGGTTAAAAACTAGGAAACAGG - Intronic
955536072 3:59925078-59925100 AAGGGAAAAAAATAGGAAGGAGG - Intronic
956176841 3:66480981-66481003 CAGAGTAAAAGCTGGGAGGGTGG + Intronic
957007150 3:74962900-74962922 CAGGGTAATACCTATGAGGGAGG - Intergenic
958711624 3:97723673-97723695 AAGGGGAAAAAAGAGGATGGAGG + Intronic
960389744 3:117063036-117063058 CTGGGTAATAACTAGGAGTGGGG - Intronic
963444532 3:145387368-145387390 AAGGGTAAAAACCAGCATGGGGG - Intergenic
963475614 3:145799885-145799907 AAGGGTAAACACTTGGAAGGAGG - Intergenic
966523248 3:180895340-180895362 CAGGATATAAAATAAGATGGAGG - Intronic
967301925 3:188022609-188022631 CAGGGGAAAAGGCAGGATGGAGG - Intergenic
968291548 3:197543327-197543349 CAGGAAAGAAACTAGGATAGGGG + Intronic
972064176 4:34918910-34918932 CAAGGTAAAAACTAGTTTGGAGG + Intergenic
972598720 4:40552879-40552901 CAGGGAGAGAGCTAGGATGGGGG - Intronic
974446702 4:61993589-61993611 CAGGGTAGAAACAATGAAGGAGG - Intronic
974873393 4:67672711-67672733 AAGTGTAAAAATTAGGTTGGCGG - Intronic
980240832 4:130172646-130172668 CAGGGTATAAGGTAGGAAGGAGG - Intergenic
980707290 4:136515907-136515929 CATGGAAATAAGTAGGATGGAGG + Intergenic
982280219 4:153676563-153676585 CAGGGTAGAAACTATGAGTGGGG + Intergenic
989853267 5:46243107-46243129 CAGGATAAAAACTAGAAAGAAGG - Intergenic
992499945 5:77332054-77332076 CAGGGTAGAAATTAGATTGGAGG + Intronic
996369827 5:122741425-122741447 CAAGGTGAATAGTAGGATGGAGG - Intergenic
996506246 5:124270763-124270785 CAGGGATAAAACTACTATGGAGG - Intergenic
998253820 5:140570040-140570062 CAGGGTGCAGACTAGGCTGGGGG - Intronic
1000838466 5:166185803-166185825 CAGTGGAATAACTAGGATGCTGG + Intergenic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1002615440 5:180451971-180451993 CATGGGGAAAAATAGGATGGAGG - Intergenic
1002644446 5:180646287-180646309 CAGGGGATAAACTGGGGTGGAGG - Intronic
1002913512 6:1509859-1509881 CAGGGTGAACCCTAGGATGCTGG - Intergenic
1005440251 6:25859868-25859890 CAGGGTAAAAAGTAAGGGGGAGG - Intronic
1005613840 6:27553714-27553736 CAGGTTTAAAACTAGGATTAAGG - Intergenic
1006177054 6:32128765-32128787 CAGGGGAAGAACCAGGATGCAGG - Exonic
1007209595 6:40181700-40181722 CAGGGTAAGAAGTAGGATTAGGG + Intergenic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1009249542 6:61280960-61280982 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1009251674 6:61308800-61308822 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1009262419 6:61510225-61510247 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1009262763 6:61515983-61516005 CAGGATAAAAACTACAATGAAGG + Intergenic
1013203388 6:107923840-107923862 CAATGTAAAATCTAGGTTGGGGG - Intronic
1013685994 6:112583771-112583793 CAGGGAAAAAACTGGGAGGTGGG - Intergenic
1013752381 6:113422345-113422367 CAGGGTCAAGACTAGAATGCTGG + Intergenic
1015547143 6:134372799-134372821 CAGGGTAAAAAGTGGGCTGATGG + Intergenic
1016517437 6:144910516-144910538 CAGGGAAAAAAATATGATTGGGG + Intergenic
1017028582 6:150201677-150201699 CAGAGTGGAAACTGGGATGGCGG + Intronic
1017367035 6:153655139-153655161 CAGTGTAAAAAGGTGGATGGGGG - Intergenic
1017484810 6:154892681-154892703 CAGGGGAAAAGAAAGGATGGGGG - Intronic
1020222414 7:6250017-6250039 CAGGGAAGAGACTGGGATGGGGG - Intronic
1021331166 7:19340381-19340403 CAGGGTGTAAAATAAGATGGAGG - Intergenic
1021479461 7:21100096-21100118 CAGGGGAAAGAGTAGGATTGTGG - Intergenic
1021601766 7:22371434-22371456 CTGATTAAAAACTAAGATGGTGG + Intergenic
1021951950 7:25783652-25783674 CTGGGTAGTAACTAGGATGATGG - Intergenic
1022181768 7:27927253-27927275 CAGGGAAGAAATTGGGATGGGGG - Intronic
1022321601 7:29293275-29293297 CAGGGGAAAATCGAGGATGCAGG - Intronic
1024655302 7:51446897-51446919 CAGGATAAAAAACAGGATGGAGG - Intergenic
1025526546 7:61820000-61820022 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1025526984 7:61826631-61826653 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1025528612 7:61847453-61847475 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1025530584 7:61877029-61877051 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1025580139 7:62703147-62703169 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1025581751 7:62728464-62728486 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1025593767 7:62898468-62898490 CAGGATAAAAACTAGAAGGAAGG - Intergenic
1025595367 7:62917012-62917034 CAGGATAAAAACTAGAAGGAAGG + Intergenic
1025614010 7:63102568-63102590 GAGGGAAAAAGCTAGGAAGGAGG - Intergenic
1030536810 7:110777453-110777475 CAAGGTTAAAACTAGGTTGTAGG - Intronic
1031169842 7:118279183-118279205 TAGGGTAAAAAGGAGGCTGGTGG + Intergenic
1033975689 7:147097776-147097798 CTGTGTAAAAATTAAGATGGTGG + Intronic
1038194313 8:25352467-25352489 CCGGGTAACAACTATGATAGAGG + Intronic
1040126516 8:43743815-43743837 CAGGATAAAAACTAGAAAGAAGG + Intergenic
1043267391 8:78283551-78283573 CAGGGCAAAGAATAGGAAGGAGG - Intergenic
1043803542 8:84642854-84642876 CAGGAGATAAAGTAGGATGGTGG - Intronic
1044998113 8:97856244-97856266 TAGAGTAAAAAATAGGAAGGGGG - Intergenic
1045760175 8:105596425-105596447 CAGGGTAAAAACTAGGATGGTGG - Intronic
1045990366 8:108299228-108299250 CAGGGTCTAATCTAGGTTGGTGG + Intronic
1046553965 8:115753144-115753166 CAGATGAAAAACTAGGATGGAGG + Intronic
1047319361 8:123765068-123765090 AAGGGTAAAAACTGGGAGGTGGG + Intergenic
1048727265 8:137400644-137400666 CAGTGTAAGAACTACGATGCAGG - Intergenic
1050912046 9:11083395-11083417 CATGGGCAAAAGTAGGATGGGGG - Intergenic
1051944491 9:22550468-22550490 CAGGGTAAAAACTTGTATACAGG + Intergenic
1051993830 9:23189002-23189024 CAAAGTAAAAAGTAAGATGGGGG - Intergenic
1052685730 9:31753211-31753233 CAGGACATAAACTAGGATTGGGG - Intergenic
1052880327 9:33597892-33597914 CAGTGTAAAAACTAGGCTGCAGG + Intergenic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1060675433 9:125510167-125510189 AAAGGTAAAAAGTAGGAAGGGGG + Intronic
1203732878 Un_GL000216v2:106743-106765 CAGAAGAAAAACTAGGATAGTGG - Intergenic
1185972047 X:4676091-4676113 CAGGGTAAAAACTAGGGCAGAGG - Intergenic
1186791738 X:13006238-13006260 CAGGGTAATTTCTGGGATGGAGG + Intergenic
1190222182 X:48519334-48519356 TAGGGTAAAAACTGGCAAGGGGG - Intronic
1191269150 X:58440185-58440207 CAGGGTAAAAACTAGAAGGAAGG - Intergenic
1193540709 X:82768357-82768379 CAGGGAAAGAACTAGAAGGGAGG - Intergenic
1194368224 X:93035705-93035727 CAGGGTAAAATCTAGAATTGCGG - Intergenic
1195863517 X:109406348-109406370 AAGGGTGAAAACTAGGAGGTAGG + Intronic
1200676432 Y:6151970-6151992 CAGGGTAAAATCTAGAACTGGGG - Intergenic
1202628071 Y:56880927-56880949 CAGAAGAAAAACTAGGATAGTGG + Intergenic