ID: 1045763324

View in Genome Browser
Species Human (GRCh38)
Location 8:105636911-105636933
Sequence TAGTATGTTGATTATCTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045763324_1045763329 14 Left 1045763324 8:105636911-105636933 CCTATGAGATAATCAACATACTA 0: 1
1: 0
2: 0
3: 10
4: 188
Right 1045763329 8:105636948-105636970 GGTAGATAAAAGACTTAAGTAGG No data
1045763324_1045763330 15 Left 1045763324 8:105636911-105636933 CCTATGAGATAATCAACATACTA 0: 1
1: 0
2: 0
3: 10
4: 188
Right 1045763330 8:105636949-105636971 GTAGATAAAAGACTTAAGTAGGG No data
1045763324_1045763325 -7 Left 1045763324 8:105636911-105636933 CCTATGAGATAATCAACATACTA 0: 1
1: 0
2: 0
3: 10
4: 188
Right 1045763325 8:105636927-105636949 CATACTACCCCATTTTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045763324 Original CRISPR TAGTATGTTGATTATCTCAT AGG (reversed) Intronic
904638602 1:31904105-31904127 TAGCATGTTTATAAGCTCATGGG + Intergenic
905217449 1:36419000-36419022 TTGTATGTTGATAACTTCATAGG + Exonic
908101790 1:60798585-60798607 TAGTATGATGATTGTACCATAGG - Intergenic
911115732 1:94245645-94245667 AAGTATGTTGAATATCCTATGGG - Intronic
911253790 1:95610912-95610934 TAATATGTTGAACATTTCATAGG + Intergenic
915005025 1:152627852-152627874 CAGTGTCTTGACTATCTCATTGG + Intergenic
919215120 1:194543297-194543319 AAGTATGTGGTTTTTCTCATTGG + Intergenic
919336456 1:196242893-196242915 CACTGTTTTGATTATCTCATAGG + Intronic
920598303 1:207295556-207295578 TAGTATTTAAATTATTTCATTGG - Intergenic
921486305 1:215719725-215719747 TAAAATGTTGCTTATCTCATAGG - Intronic
924910484 1:248506609-248506631 TTGGATGTTTATTATATCATTGG + Intergenic
924913616 1:248541430-248541452 TTGGATGTTTATTATATCATTGG - Intergenic
1063732686 10:8717322-8717344 TTCTTTATTGATTATCTCATTGG + Intergenic
1064648943 10:17488778-17488800 TATTATGTTTATTATCTGACAGG + Intergenic
1064658929 10:17586150-17586172 CAGTGTGTTGATAATCTGATGGG - Intergenic
1065480153 10:26184979-26185001 TTGTATGCTGATAAGCTCATGGG + Intronic
1066725351 10:38386356-38386378 TAGTAGGTTAATTATCCAATTGG - Intergenic
1067679226 10:48417276-48417298 TAGTATCTTTTTTAGCTCATGGG + Intronic
1069099438 10:64300325-64300347 AAGTATGATGATTATTTGATAGG - Intergenic
1069576658 10:69535400-69535422 TAGTATTATTATTAACTCATGGG - Intergenic
1069583877 10:69583980-69584002 TAGAATGATGCTTAGCTCATGGG + Intergenic
1072175762 10:92919760-92919782 TAGTATGTTTATTATCACTGTGG - Intronic
1073862125 10:107758260-107758282 CAGTATATTGGTTATCTTATGGG + Intergenic
1077958056 11:7042657-7042679 AAGTATGTTTTTTATCTCAATGG + Exonic
1078843432 11:15100449-15100471 TAGTTTGATGATTATCTCTCTGG + Intergenic
1079556628 11:21766538-21766560 TAATCTGTTGATAAACTCATTGG + Intergenic
1079790561 11:24733311-24733333 TATTATTTTAATTATTTCATTGG + Intronic
1080317044 11:30961335-30961357 TACTATGTTCATTACCTTATTGG - Intronic
1085695369 11:78699954-78699976 AATTATCTTGATTAACTCATTGG - Intronic
1086159198 11:83702381-83702403 TAGAATGTGACTTATCTCATGGG + Intronic
1086839854 11:91671702-91671724 TAGTATGTGAATAATGTCATTGG - Intergenic
1087388578 11:97505442-97505464 AAATAAGTTGATTTTCTCATTGG - Intergenic
1088534455 11:110844998-110845020 TAGTATGTTGATTTTATATTTGG + Intergenic
1093475028 12:19545202-19545224 TAGTATATTGATTTTGTCACAGG + Intronic
1094746983 12:33356219-33356241 TACTCTGTTGATTATTTCCTTGG + Intergenic
1095713991 12:45321790-45321812 AAGTATGATGATTGTCTCAAGGG - Intronic
1096315836 12:50564746-50564768 TAGTATGTTAATTTTGTCATTGG + Intronic
1096858783 12:54507534-54507556 TAAAATGTAGATTATCTAATAGG - Intronic
1097994505 12:65872849-65872871 TCTTATGTTGATTATAGCATTGG + Intronic
1100258931 12:92913481-92913503 TTGTCTGTTGATTATTTCTTTGG + Intronic
1100697932 12:97115795-97115817 TAATATGTTGATTATCACACGGG - Intergenic
1101307628 12:103545079-103545101 TAGTAATTTGATTACCTCTTTGG + Intergenic
1101853280 12:108421575-108421597 TAGTCTGTAGAATATCACATGGG + Intergenic
1107316408 13:39137008-39137030 TAGTTTGTACATTTTCTCATTGG - Intergenic
1107563440 13:41578060-41578082 TAGTATGTTTTTTTTCTCCTAGG - Intronic
1107687454 13:42917903-42917925 AACTATGTTGATTATCTCTGAGG - Intronic
1108189522 13:47923307-47923329 TAGTCTGTTGATTATTTCTTTGG - Intergenic
1108259551 13:48643165-48643187 TATAATGTTGATTATCTTATAGG - Intergenic
1108902450 13:55428811-55428833 TACTCTGTTGATTGTCTCCTTGG - Intergenic
1111468703 13:88648363-88648385 TAGTACTTTTATTACCTCATAGG - Intergenic
1111701953 13:91701622-91701644 CATTATGTTGATTGTTTCATTGG + Intronic
1116087216 14:40255407-40255429 TAGTATTTTGTTTATTGCATTGG + Intergenic
1116447568 14:45028513-45028535 GAATATCTTGATTATCTCAAAGG + Intronic
1116449110 14:45044994-45045016 TAGTATAATGTTTATCTCATAGG - Intronic
1116709691 14:48351620-48351642 TATTATGTTCATTATTTTATCGG + Intergenic
1116756858 14:48958750-48958772 TAGTATGCTGATAGTATCATTGG - Intergenic
1124167899 15:27344670-27344692 TTGTAGGTTGATTAACTAATTGG + Intronic
1124502289 15:30239503-30239525 TAGTAAGTATATTTTCTCATGGG + Intergenic
1124741274 15:32299148-32299170 TAGTAAGTATATTTTCTCATGGG - Intergenic
1125117473 15:36111969-36111991 TAGTTTCTGGATTTTCTCATGGG + Intergenic
1125137141 15:36356929-36356951 CAGTAAATTGATTATTTCATGGG + Intergenic
1125395886 15:39247509-39247531 TACTATGTTGGTTATCTCTGGGG + Intergenic
1127163055 15:56211818-56211840 AGGTATGTTTAGTATCTCATTGG - Intronic
1128390370 15:67178731-67178753 TAGAATATAGCTTATCTCATTGG + Intronic
1131557326 15:93411207-93411229 AAGTATGCTGTTTATCTTATAGG - Intergenic
1132267471 15:100487391-100487413 AATTATATTGCTTATCTCATAGG - Intronic
1133152561 16:3847277-3847299 TACTATTTTAATTATTTCATAGG + Intronic
1135417892 16:22282916-22282938 TAGTATGTTTATTATATGTTAGG - Intronic
1139222185 16:65194837-65194859 TACTCTGTTGATTATTTCCTGGG + Intergenic
1140436838 16:74954069-74954091 AAGGATGTTGAGTATCTTATTGG - Intronic
1141058443 16:80840875-80840897 AAGTATGTTGACTATAGCATGGG - Intergenic
1141292541 16:82733569-82733591 TGGAATGTTGAATGTCTCATAGG - Intronic
1150962815 17:69933706-69933728 TAATATTTTGATGATATCATGGG - Intergenic
1156087675 18:33426459-33426481 TAATATTTTTATTGTCTCATGGG - Intronic
1156090205 18:33458684-33458706 TAATATGTTGTTTATCTTTTAGG - Intergenic
1158736807 18:60091683-60091705 TAGTAAGTTGAAAATATCATAGG + Intergenic
1159367615 18:67489751-67489773 TAGAAGTTTGAATATCTCATTGG - Intergenic
1159406966 18:68016253-68016275 TAGTATGTTTAGTATATTATAGG - Intergenic
1161504801 19:4638299-4638321 AAGTAAGTTAAATATCTCATTGG - Intergenic
1167275977 19:48539717-48539739 CTGTATGTTGGTTTTCTCATTGG + Intergenic
1168662868 19:58181963-58181985 TAGTGTGTTGATTTTGGCATAGG - Intergenic
928418674 2:31120374-31120396 TCTTATGTTGCTTATCTCAAAGG + Intronic
928542703 2:32298433-32298455 TAATATGTTGATCATCTTAAAGG - Intronic
929200414 2:39229214-39229236 TAATAAGTTGATTATCACTTTGG - Intronic
932953534 2:76323067-76323089 TAATATGTGCATTATATCATAGG - Intergenic
933185116 2:79269838-79269860 TAGCATGTTCACTAACTCATGGG + Intronic
934607349 2:95706798-95706820 TTCCATGTTCATTATCTCATTGG - Intergenic
935874250 2:107488737-107488759 CAGTATTTTGATTTTCCCATGGG - Intergenic
936540753 2:113348981-113349003 TTCCATGTTCATTATCTCATGGG - Intergenic
936603834 2:113927764-113927786 TAGTCTGATTATTATATCATTGG + Intronic
936910538 2:117587368-117587390 TAGAATGGTGATTATCAAATGGG + Intergenic
939449862 2:142360170-142360192 TAATATGTAGGTTATCACATTGG + Intergenic
939547384 2:143570074-143570096 TAACAGGTTCATTATCTCATGGG - Intronic
943812876 2:192211628-192211650 TAGTATGCCTTTTATCTCATCGG + Intergenic
944159790 2:196646122-196646144 TGGGATGTTGCTCATCTCATAGG + Intronic
945713061 2:213324180-213324202 TAGAGTGTTGATTATCCTATAGG - Intronic
947435671 2:230069871-230069893 GATTATCTGGATTATCTCATTGG - Intergenic
1169867203 20:10214971-10214993 TTGTATCTCAATTATCTCATAGG - Intergenic
1170431320 20:16279255-16279277 TAGTAGCTTGATTAGCTCTTTGG - Intronic
1170758543 20:19227769-19227791 TAGCATGTTAATTATCTGGTAGG + Intronic
1171271308 20:23820008-23820030 TACTATATTGATTACCTCATGGG - Intergenic
1173636577 20:44564231-44564253 AAGTATCTTGATCATCTCTTAGG + Intronic
1174728893 20:52894949-52894971 AAATATGATGATTATCTAATGGG + Intergenic
1182005856 22:26959034-26959056 CAGTATCTGGATTTTCTCATTGG + Intergenic
1182828292 22:33284258-33284280 CAGTTTGGTGATTCTCTCATCGG - Intronic
949245309 3:1919531-1919553 AAGTATGTGGTTCATCTCATTGG - Intergenic
951911686 3:27756702-27756724 TAATATGTTGGTTTTCCCATGGG + Intergenic
954065656 3:48103929-48103951 TACTCTGTTGATTATTTCTTTGG + Intergenic
955743524 3:62118017-62118039 TTTTATGTGGATTATCTCATTGG + Intronic
956894302 3:73644023-73644045 TTTTATGTTGATTGTCTGATGGG + Intergenic
957396843 3:79651189-79651211 TAGGATGTTCATTAGCTCTTAGG + Intronic
957590670 3:82193417-82193439 TTGTATGTTTATTTTATCATCGG + Intergenic
957654293 3:83052866-83052888 TAGTGTGTTTATTATTTAATTGG - Intergenic
959018740 3:101165569-101165591 CAGAGTTTTGATTATCTCATTGG + Intergenic
962684492 3:137833930-137833952 TAGTATTTTAATTACCTGATGGG + Intergenic
965185374 3:165455775-165455797 TAGTCTGCTGATTATTTCTTTGG - Intergenic
970414052 4:15838979-15839001 TACTATGTTGATTACCTTTTCGG + Intronic
971668652 4:29527111-29527133 TAGAATCTTGATTCTCTTATTGG - Intergenic
971827031 4:31637234-31637256 TAGTATGTGAATTATCTCTCAGG + Intergenic
975082045 4:70293253-70293275 TAATTTCTTGATTATTTCATTGG + Intergenic
977454571 4:97242190-97242212 TAATATGTAGATTTTCTGATTGG - Intronic
977692536 4:99930937-99930959 TACTTTGTGGATGATCTCATTGG - Intronic
977907305 4:102492794-102492816 TATTATGGTGATGGTCTCATGGG + Intergenic
980572247 4:134635422-134635444 AATTATGTTGATCATTTCATTGG + Intergenic
980594141 4:134930155-134930177 TCGGATTTTGATTATTTCATAGG - Intergenic
980872358 4:138624945-138624967 TAGTATCTTTATTATCTCTCGGG + Intergenic
982781664 4:159497695-159497717 TATGATGTTCTTTATCTCATAGG + Intergenic
983550609 4:169013697-169013719 AAGCATGTTGATTTCCTCATTGG + Intergenic
983765620 4:171478911-171478933 TAGGATGTTGTGTATCTCTTAGG + Intergenic
987194817 5:15515871-15515893 TAGTAATTTGATAATCTCAGTGG - Intronic
987984652 5:25130832-25130854 ACATATGTTGATTTTCTCATAGG - Intergenic
988220772 5:28344266-28344288 AAATATGTTGATTATTTTATTGG + Intergenic
988347009 5:30050252-30050274 TAGAATGTTCTTTATCTCATTGG + Intergenic
988867787 5:35354391-35354413 CAGTATCTGGCTTATCTCATAGG - Intergenic
990802649 5:59622519-59622541 TATTATCTTGATGATCACATTGG + Intronic
992881468 5:81114508-81114530 TAAAATGTTGATTAGGTCATAGG + Intronic
993249645 5:85503225-85503247 TGGAATGTTGATAATCTCAGTGG - Intergenic
994608674 5:102007410-102007432 TAATATTTTGGTTATCTCACAGG + Intergenic
995467990 5:112470475-112470497 TTATATGTAGATTATTTCATTGG + Intergenic
995892120 5:116966456-116966478 TTGCATCTTGATTATATCATTGG - Intergenic
996281957 5:121740813-121740835 CATTATGTTTATTTTCTCATGGG - Intergenic
996928910 5:128862297-128862319 CAGTATGGTGCCTATCTCATTGG - Intronic
996986575 5:129573871-129573893 AAATATGTTGATTATATCCTTGG + Intronic
1000432076 5:161164000-161164022 TATTATGTTTATTATCTACTGGG - Intergenic
1000496006 5:161986076-161986098 TAGTTATTTGACTATCTCATAGG + Intergenic
1001395038 5:171412641-171412663 TGGTATGTTGATTGCCTCACTGG + Intergenic
1003284136 6:4719521-4719543 TATTCTGTTGATTAGCTAATAGG - Intronic
1003724763 6:8748440-8748462 TATTGTGTTCATTATCACATAGG + Intergenic
1005504648 6:26459051-26459073 CAAAATGTTGACTATCTCATTGG - Intronic
1006595660 6:35191261-35191283 TAATTTGTTGGTAATCTCATGGG + Intergenic
1008145001 6:47880445-47880467 TATAATGTTGATAATCTCCTTGG + Intronic
1008372829 6:50754919-50754941 TAGTCTGTTGATTGTGTCTTTGG + Intronic
1008542533 6:52557699-52557721 TATTATGATGATTAACTCACAGG - Intronic
1008692142 6:53991601-53991623 TTGTATTTCAATTATCTCATTGG + Intronic
1008698560 6:54071087-54071109 TAATGTATTGATTCTCTCATAGG + Intronic
1009452695 6:63819864-63819886 TGGTAGGTTGATTACATCATGGG - Intronic
1010757603 6:79684362-79684384 TAGTATGATATTTATCTCATAGG + Intronic
1012180147 6:96142942-96142964 TTTTATGTAGATTATATCATGGG + Intronic
1012332751 6:98014033-98014055 TAGTATGTTGTTCTTCTAATAGG - Intergenic
1013801359 6:113949075-113949097 TTGTGTGTAGATTATCTCAAAGG - Exonic
1014412415 6:121142504-121142526 TAGAATGCTGATTATTTTATAGG + Intronic
1017697113 6:157027321-157027343 TATTATTTTGATTATCAAATTGG - Intronic
1017938310 6:159026800-159026822 TAGATTTTTGCTTATCTCATGGG + Intergenic
1021228535 7:18057495-18057517 GAGTATGTTTATTAATTCATTGG + Intergenic
1021295380 7:18899588-18899610 TAGTATATTAATTATTTCTTTGG + Intronic
1023292857 7:38686221-38686243 TTTTATGTTCATTATCTCCTGGG - Intronic
1027877940 7:83795710-83795732 TAGTATTTAGATAATCTCTTGGG - Intergenic
1028451336 7:90987880-90987902 TACAAAGTTGATTATCTCCTTGG - Intronic
1030409333 7:109155666-109155688 TAGTATGTAGTTTAACTCAGAGG + Intergenic
1030839339 7:114328857-114328879 TAGTATGTGCATTATTTCAAGGG - Intronic
1032292695 7:130603180-130603202 TAGTATAGTGATTATCTCTGAGG - Intronic
1032640181 7:133757811-133757833 TAGTAAGGTAACTATCTCATAGG - Intronic
1033084341 7:138328575-138328597 GAGTATGTTGATCAACTCACAGG - Intergenic
1036016774 8:4794381-4794403 TAGTGTCTTGATTTTCTAATGGG - Intronic
1039051090 8:33494401-33494423 AAGTATGCTGGTTATCTAATGGG - Intronic
1042431810 8:68715305-68715327 TACTCTGTTGATTATTTCTTTGG - Intronic
1044123610 8:88429586-88429608 TATTTTGTTGATTAACTCCTTGG + Intergenic
1045368958 8:101502152-101502174 TCTTATGTTAATTATCTTATTGG - Intronic
1045645793 8:104296584-104296606 GAGTGTGTTTATTATGTCATGGG + Intergenic
1045763324 8:105636911-105636933 TAGTATGTTGATTATCTCATAGG - Intronic
1046257206 8:111716646-111716668 TTGAATAGTGATTATCTCATTGG + Intergenic
1047546995 8:125827900-125827922 TAGTATGTTGAGCACCTGATAGG + Intergenic
1050563775 9:6861256-6861278 CAGGAAGTTGAATATCTCATGGG - Intronic
1051051822 9:12942646-12942668 AAATGTGTTGATTATTTCATTGG + Intergenic
1052419936 9:28231034-28231056 TAGTATATTCATTGTCTTATAGG - Intronic
1053388003 9:37710489-37710511 TACTATCTTGATTATATGATTGG + Intronic
1055607617 9:77987240-77987262 TATTATCTTGAGTATCTCTTTGG + Intronic
1058520315 9:105809550-105809572 TATTATGAAGAATATCTCATGGG - Intergenic
1059816270 9:117919335-117919357 TAGTATGACTATTATTTCATAGG - Intergenic
1060950346 9:127597973-127597995 TAGAATAATGATTGTCTCATGGG - Intergenic
1062728170 9:138090587-138090609 CACTCTGTTGATTATTTCATTGG - Intronic
1188762538 X:34050290-34050312 TGATAGGTTGATTATATCATAGG - Intergenic
1189120718 X:38391563-38391585 TAGTATCTTTATAAACTCATTGG + Intronic
1189138462 X:38575642-38575664 TGGTATGTACATTTTCTCATAGG - Intronic
1189218328 X:39346344-39346366 AAGTATGTTGTTAATCTGATAGG - Intergenic
1190934912 X:54990031-54990053 TAGTAGGCCAATTATCTCATTGG + Intronic
1192714933 X:73629267-73629289 TATTTTGTTGATTGTCTCCTTGG + Intronic
1193453391 X:81699270-81699292 TAGGATTTTGTTTATCTCACTGG + Intergenic
1195030096 X:100918662-100918684 GAGAATGATAATTATCTCATAGG + Intronic