ID: 1045763327

View in Genome Browser
Species Human (GRCh38)
Location 8:105636935-105636957
Sequence TTTATCTACCTTTGTAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 649
Summary {0: 1, 1: 0, 2: 4, 3: 69, 4: 575}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045763327_1045763331 8 Left 1045763327 8:105636935-105636957 CCCATTTTACAAAGGTAGATAAA 0: 1
1: 0
2: 4
3: 69
4: 575
Right 1045763331 8:105636966-105636988 GTAGGGTAAATAATTTGCCATGG No data
1045763327_1045763332 16 Left 1045763327 8:105636935-105636957 CCCATTTTACAAAGGTAGATAAA 0: 1
1: 0
2: 4
3: 69
4: 575
Right 1045763332 8:105636974-105636996 AATAATTTGCCATGGTCACATGG No data
1045763327_1045763329 -10 Left 1045763327 8:105636935-105636957 CCCATTTTACAAAGGTAGATAAA 0: 1
1: 0
2: 4
3: 69
4: 575
Right 1045763329 8:105636948-105636970 GGTAGATAAAAGACTTAAGTAGG No data
1045763327_1045763330 -9 Left 1045763327 8:105636935-105636957 CCCATTTTACAAAGGTAGATAAA 0: 1
1: 0
2: 4
3: 69
4: 575
Right 1045763330 8:105636949-105636971 GTAGATAAAAGACTTAAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045763327 Original CRISPR TTTATCTACCTTTGTAAAAT GGG (reversed) Intronic
903008186 1:20312082-20312104 TTTATCTACCCTCTTAATATTGG - Intronic
903091291 1:20920243-20920265 TTTAACTAAGTTTTTAAAATAGG + Intronic
905170199 1:36105399-36105421 ATTTCCTACCTCTGTAAAATGGG - Intronic
905280276 1:36844620-36844642 TTTACCTCCTTCTGTAAAATGGG + Intronic
905338609 1:37262655-37262677 TTTTTCTCCCTCTGGAAAATTGG - Intergenic
906700520 1:47854147-47854169 TTTCTGAACCTCTGTAAAATGGG + Intronic
906919186 1:50045884-50045906 TTTATCTAGCTGTGTAAATTTGG + Intergenic
907062445 1:51443959-51443981 TTTATTAATCTTTTTAAAATGGG + Intronic
907408167 1:54266676-54266698 GTTTTCCCCCTTTGTAAAATGGG - Intronic
907538236 1:55185281-55185303 TCTTTCTTCCTTTGTAATATAGG - Intronic
907562626 1:55404966-55404988 TTTTTCAACATCTGTAAAATGGG + Intergenic
908577910 1:65480696-65480718 TTTTTCCTCTTTTGTAAAATGGG - Intronic
908646689 1:66286178-66286200 TTTTCCTTTCTTTGTAAAATTGG + Intronic
909548464 1:76872658-76872680 TTTATATACTTTTCTAAAAGGGG - Intronic
909596902 1:77416178-77416200 TTTTTCTACCTTTGTACTTTTGG - Intronic
910089350 1:83443689-83443711 TTTATCTACCTGTGTCTCATAGG + Intergenic
910412105 1:86957300-86957322 TGTTTCTTCCTCTGTAAAATGGG - Intronic
910440409 1:87246134-87246156 TTCAACTTCATTTGTAAAATGGG + Intergenic
910554565 1:88516897-88516919 TTAATTTGCTTTTGTAAAATAGG + Intergenic
910735395 1:90448566-90448588 TTTGCATTCCTTTGTAAAATTGG - Intergenic
911126075 1:94342193-94342215 GTTTTCATCCTTTGTAAAATGGG - Intergenic
911436766 1:97869791-97869813 TTTATCTCCCTTTATTAAAATGG + Intronic
911456590 1:98131930-98131952 TTTATCTTCCAGTGTAAAGTAGG - Intergenic
911684952 1:100765025-100765047 TTCATCAACCATTGTAAAAGGGG + Intergenic
911788137 1:101977109-101977131 TAATTCTACCTTTGAAAAATTGG - Intronic
911873043 1:103123680-103123702 TTTTTCTCACTTTGTAAAAATGG + Intergenic
912530627 1:110318537-110318559 TTTATCTAAATTTCTAATATTGG - Intergenic
912905664 1:113703920-113703942 TTTTTCTAACTTTTCAAAATGGG - Intronic
914390169 1:147213997-147214019 TTTATAGTTCTTTGTAAAATGGG - Intronic
915420674 1:155778931-155778953 TTTATCTACTGCTGTAATATCGG + Intronic
915568542 1:156730807-156730829 TGTTTCTACATCTGTAAAATGGG + Intronic
915883079 1:159693757-159693779 TTTATTTTCCTTTTTAAAAGTGG - Intergenic
916742797 1:167661213-167661235 ATTTTCTTCCTCTGTAAAATGGG - Intronic
917031489 1:170697282-170697304 ATTAGTTACTTTTGTAAAATGGG + Intronic
917908861 1:179618971-179618993 TTAATGTACATTTATAAAATTGG - Intronic
918033325 1:180839736-180839758 TTTATCATTCTTTGTAAAAATGG - Intronic
918264440 1:182828150-182828172 TTAAACTACCTATGTAAAACTGG - Intronic
918546569 1:185691220-185691242 TTTATTTACATTTTTAAAATGGG - Intergenic
919222827 1:194653158-194653180 TTTAGATAACTTTTTAAAATAGG + Intergenic
921357629 1:214300793-214300815 ATTATCTTCATTTGAAAAATAGG + Intronic
921545638 1:216471798-216471820 TTTATCTACTTTTGCACAAATGG - Intergenic
921734888 1:218615655-218615677 TTTATCACCCTTTGTTAAAATGG + Intergenic
921752820 1:218817289-218817311 TTTTTCTACCTTAAAAAAATTGG - Intergenic
921805078 1:219444971-219444993 CTTTTGTACTTTTGTAAAATGGG + Intergenic
921827901 1:219694465-219694487 TTGATATACCTTTGTATAAAAGG - Intronic
923018124 1:230142501-230142523 TGTTTCCTCCTTTGTAAAATGGG + Intronic
923315470 1:232775872-232775894 TATATCCACATCTGTAAAATGGG + Intergenic
923377073 1:233374584-233374606 TTTATATCACTTTGTAAAATTGG - Intronic
923674476 1:236067814-236067836 TTTCACTACCTGTGTAAAACTGG - Intergenic
923893139 1:238237690-238237712 TTTATTAACCTTGGTAAATTTGG - Intergenic
924028842 1:239866513-239866535 TTTAAATACCTTTGTAAACTAGG + Intronic
1062999932 10:1906986-1907008 TTTTTCTTCCTTTATTAAATGGG + Intergenic
1064217688 10:13414317-13414339 TTTATCACCCTTTGTTAAAATGG + Intergenic
1064588315 10:16862353-16862375 TCTTTCTTCCTTTGTAAAATGGG + Intronic
1064687617 10:17879771-17879793 TTCATCTTCATTTGCAAAATTGG - Exonic
1067602956 10:47626647-47626669 ATTATTTACCCTTGTAAAAGTGG + Intergenic
1067667204 10:48288726-48288748 TTTATCTACCATTGAAGAAGGGG + Intergenic
1067998423 10:51302850-51302872 ATTATCCTCCTTTTTAAAATAGG + Intronic
1068131699 10:52902987-52903009 TTTATGTCCCTTTGTTAAAGTGG + Intergenic
1068308900 10:55253747-55253769 TGTGGCTACATTTGTAAAATGGG + Intronic
1069100624 10:64316187-64316209 TATTTCTACCTGAGTAAAATGGG + Intergenic
1069560949 10:69428959-69428981 GGTTTCTTCCTTTGTAAAATGGG - Intergenic
1069638355 10:69939308-69939330 TTTAACTTCCTTTGAAAAATAGG - Intronic
1070004715 10:72412387-72412409 TCTATCTACCTTTGGAAAGATGG + Intronic
1070222718 10:74466902-74466924 TTTATCTAGATTTGTTAAAGTGG - Intronic
1070509102 10:77143989-77144011 TGTATCTTCCTTTGGAAAACTGG + Intronic
1070567898 10:77617687-77617709 TTTTTGTACATCTGTAAAATGGG + Intronic
1070684694 10:78471998-78472020 TTTTTCTTCATTTTTAAAATAGG - Intergenic
1071173898 10:82900689-82900711 ATTTTCTTCATTTGTAAAATGGG - Intronic
1071680813 10:87703588-87703610 CTTATCTTTCTCTGTAAAATGGG - Intronic
1071702813 10:87959604-87959626 TTTATTTAGCTTTCAAAAATAGG + Intronic
1071753669 10:88511007-88511029 TTTTTTTTCATTTGTAAAATGGG - Intronic
1071923103 10:90373790-90373812 TTTATCTTCCTTTGACATATGGG + Intergenic
1071936457 10:90536729-90536751 TTGTTCTACTTTTGTAAAATCGG - Intergenic
1072201965 10:93168298-93168320 TTTATCTTCCTTTGGCAATTGGG - Intergenic
1072295152 10:94001837-94001859 TTTATCCACCTTTCTGAGATTGG - Intronic
1072715873 10:97752238-97752260 TTTATTTCTCTTTGTAAAGTGGG + Intronic
1072736699 10:97883947-97883969 GTTTTCTTCCTCTGTAAAATGGG + Intronic
1073822854 10:107284996-107285018 TTTTTCTCCATTGGTAAAATGGG + Intergenic
1074173735 10:110974485-110974507 TTTTTCTATCTTTTTAAAATGGG + Intronic
1074262980 10:111872401-111872423 TTGTTCTACCATTGTAAGATGGG + Intergenic
1074282807 10:112069347-112069369 TTCCTCTACCTTTGAAATATCGG - Intergenic
1074689142 10:115988653-115988675 TTTATCACAATTTGTAAAATGGG + Intergenic
1075164363 10:120053658-120053680 TTCTTCTGGCTTTGTAAAATGGG + Intergenic
1078313419 11:10269764-10269786 TTTATCTATTTTTGTAGAAATGG + Intronic
1079270980 11:18985877-18985899 TTTATTTGCCTTTGTCATATTGG + Intergenic
1079378543 11:19916345-19916367 TTTCTCTTTCTTAGTAAAATTGG - Intronic
1079392299 11:20033172-20033194 TATTTCTTCATTTGTAAAATGGG + Intronic
1079481801 11:20889146-20889168 TTTATCTTGATTTGTATAATAGG - Intronic
1079856247 11:25609474-25609496 TTTTTCTGCCTTTGTCAGATTGG + Intergenic
1080000972 11:27349533-27349555 TTTTTCCACATTTGTAAAACTGG + Intronic
1080684049 11:34501040-34501062 ACTTTCTCCCTTTGTAAAATGGG - Intronic
1080974300 11:37318376-37318398 TTAATCAACTTTTATAAAATTGG + Intergenic
1082727498 11:56753819-56753841 TTTATTTACCTATGTAAATATGG - Intergenic
1083045369 11:59729666-59729688 TTTATTTACATTTGTAAAAGGGG + Intronic
1083117904 11:60481788-60481810 TATTTCTTCCTCTGTAAAATAGG - Intergenic
1083157646 11:60834796-60834818 TTTCTCCACCTCTGAAAAATAGG + Intergenic
1083590474 11:63890808-63890830 TTCATCTACCTGTGTAAAGTAGG + Intronic
1085363604 11:75916283-75916305 TTAGTCTGCTTTTGTAAAATGGG + Intronic
1085588402 11:77733399-77733421 TTTATCTTCCTTAGTATACTTGG + Intronic
1086045202 11:82524412-82524434 TTAATCTGCCTCTCTAAAATGGG - Intergenic
1086136992 11:83451653-83451675 TTTAACTATCTTTTTAAAATAGG + Intergenic
1086139500 11:83479500-83479522 TTTATATTCCTTAGTGAAATGGG - Intronic
1086236083 11:84632521-84632543 TTTAGCTCCATTTGTAAAATGGG - Intronic
1087296683 11:96385558-96385580 TCTTTATACCTTAGTAAAATGGG + Intronic
1087395766 11:97595753-97595775 CTTATCTACTTTTTTAAAATAGG + Intergenic
1087717906 11:101630373-101630395 TTTATTTATGTTTATAAAATAGG + Intronic
1088150082 11:106734406-106734428 TTTATGTACCCTTTTACAATAGG + Intronic
1088226052 11:107621566-107621588 CTTGTCCTCCTTTGTAAAATGGG - Intronic
1088238717 11:107752055-107752077 ATTATTTACCTTTGAAAAAATGG - Intergenic
1088529737 11:110796046-110796068 TTTTTCCAACTTTGGAAAATTGG + Intergenic
1089012796 11:115144355-115144377 AGTTTCTGCCTTTGTAAAATGGG - Intergenic
1089729206 11:120510323-120510345 TTTAACATCCTCTGTAAAATGGG + Intergenic
1090071432 11:123547734-123547756 TTTATTTATCTTTGAACAATAGG + Intronic
1090215570 11:124960144-124960166 TTTTTTTAGCTTTGTAAAGTGGG + Intronic
1090256092 11:125285495-125285517 TGTATCTTCATCTGTAAAATGGG + Intronic
1090672212 11:128956492-128956514 TAAAACTACCTTTGTAAAAGTGG + Intergenic
1090970139 11:131634760-131634782 TGTTTCTGTCTTTGTAAAATGGG + Intronic
1091085056 11:132713494-132713516 TTTTTTTATCATTGTAAAATAGG - Intronic
1093215055 12:16352116-16352138 TTTTTCTTCTTTTGTGAAATGGG + Intronic
1093727073 12:22526384-22526406 AATTTCTTCCTTTGTAAAATGGG - Intronic
1093890852 12:24518647-24518669 TTTATTCCCCTCTGTAAAATAGG + Intergenic
1093968725 12:25354864-25354886 AATATCTTCATTTGTAAAATTGG - Intergenic
1094304238 12:28999753-28999775 TTTATTTATTTTTGTTAAATGGG - Intergenic
1094603248 12:31929100-31929122 TTTATGTACCTTTTTAACAAAGG + Intergenic
1094823256 12:34244477-34244499 TTTATCCTCCTGTGTAAAACTGG + Intergenic
1095091421 12:38110565-38110587 TTTATCTTCTTGTGTAAAATTGG - Intergenic
1095154586 12:38836678-38836700 TTTATTTCACTTTGCAAAATTGG + Intronic
1095239919 12:39846055-39846077 TTCATCTACCTGTGTAACAGAGG + Intronic
1095241399 12:39863752-39863774 TCTATGTGCCTTTGGAAAATAGG - Intronic
1095843617 12:46721740-46721762 TTTATTTACTTTTTTAAAAATGG + Intergenic
1096037846 12:48488425-48488447 GTCATCTACCTCAGTAAAATTGG + Intronic
1096522612 12:52192713-52192735 TTTGTCTTCATTTGTAAAGTGGG + Intergenic
1097143222 12:56921013-56921035 TTTATCTCCATTTTTAAAGTAGG - Intergenic
1097327166 12:58289893-58289915 ATTTAATACCTTTGTAAAATTGG - Intergenic
1097478126 12:60084716-60084738 TTGGTCTATCTTTGTAGAATAGG + Intergenic
1097628227 12:62027778-62027800 ATTTTCTACCTATGAAAAATTGG - Intronic
1098600137 12:72321406-72321428 TTTATGTATCTTTTTAAATTTGG - Intronic
1100015783 12:90009324-90009346 TTAATCGACCTTTTGAAAATGGG + Intergenic
1101531681 12:105579419-105579441 TTTATTTACATTTTTAAAAGAGG - Intergenic
1101735160 12:107457962-107457984 AGTTTCTTCCTTTGTAAAATAGG + Intronic
1102997986 12:117364469-117364491 ATTTTCTCCCTCTGTAAAATGGG - Intronic
1103365770 12:120382055-120382077 TTTCTCAACCTTTTTAAAATTGG - Intergenic
1104052260 12:125203720-125203742 TTCCTCTTCCCTTGTAAAATTGG + Intronic
1104217020 12:126743489-126743511 TTTATTTCCCCTTGTAAAAGTGG - Intergenic
1105633168 13:22192123-22192145 TTTAAATAGCTTTATAAAATTGG + Intergenic
1106166685 13:27253126-27253148 CTCATCTTCATTTGTAAAATAGG - Intronic
1106415889 13:29545448-29545470 TGTTTCTACGTGTGTAAAATGGG + Intronic
1106920457 13:34557633-34557655 TCTATGCACCTTTTTAAAATAGG + Intergenic
1106998110 13:35511484-35511506 TTTTTCTTTCTTTGTCAAATGGG - Intronic
1107573126 13:41685003-41685025 TTAAACCACCTTTGTAAATTAGG + Intronic
1107785163 13:43948277-43948299 TTTATCACCCTTTGTTAAAGTGG + Intergenic
1108230513 13:48334981-48335003 ATTATCTACAATTGTAAAATAGG - Intronic
1108388310 13:49922452-49922474 TTTAGCTTCATCTGTAAAATGGG - Intronic
1108463840 13:50694852-50694874 TTCATCTAACTTTATAAAATAGG + Intronic
1108766287 13:53634158-53634180 TTTTTCTACATTAGTAAAACAGG - Intergenic
1109821462 13:67662036-67662058 ATTATGTATCTTTGAAAAATAGG + Intergenic
1109935161 13:69272807-69272829 TTTTTCTTCATTTGTAAAACTGG + Intergenic
1110326533 13:74222547-74222569 TTATTTTACCTTTTTAAAATAGG + Intergenic
1110422643 13:75330575-75330597 TTTAACTAGCTGTGTAAACTTGG - Intronic
1110596146 13:77322684-77322706 TTTTTCTACTTGTGTTAAATTGG - Intronic
1110635530 13:77763227-77763249 TTTATGTACCCTTGAAAAATGGG + Exonic
1110968181 13:81727358-81727380 TTTATATACCTTGGAAATATTGG + Intergenic
1111217004 13:85157102-85157124 TTTATCTACTTTACTAAAACAGG + Intergenic
1111307742 13:86437071-86437093 TTTATATATTTTTATAAAATAGG - Intergenic
1111700440 13:91681173-91681195 TTTATTTGCCATTGTAAAAGTGG + Intronic
1111757583 13:92418074-92418096 TTTATATACATTTTTAGAATTGG + Intronic
1113132028 13:107047637-107047659 TATATATACATTTGAAAAATTGG - Intergenic
1113278463 13:108761677-108761699 TTTTACTACCTGTGTAAACTTGG - Intronic
1114034960 14:18615359-18615381 TATTTCTCCATTTGTAAAATGGG - Intergenic
1114082027 14:19209672-19209694 TTTACCTTCCTTTGCCAAATGGG - Intergenic
1114123686 14:19699657-19699679 TATTTCTCCATTTGTAAAATGGG + Intergenic
1114732219 14:25005148-25005170 TTTATTTACCTTTTTAAAAGGGG + Intronic
1114739888 14:25085020-25085042 TTTGAAAACCTTTGTAAAATAGG + Intergenic
1115637310 14:35302710-35302732 TTTTTCTGCCTTTTTAAGATTGG + Intronic
1116854605 14:49940582-49940604 ATTTTCTCCATTTGTAAAATGGG + Intergenic
1117025647 14:51617209-51617231 TTTACCTACCTTTGGAATGTGGG + Intronic
1117243114 14:53855556-53855578 TTTATTTACATTTTTAAAAGGGG + Intergenic
1117412372 14:55461977-55461999 TCTTTCTTCCTTTTTAAAATGGG - Intergenic
1117490700 14:56243973-56243995 TTTATGAAACTTTGTCAAATAGG + Intronic
1117902064 14:60544546-60544568 ATTATCTACCTTTATAGAGTGGG + Intergenic
1118900946 14:69985095-69985117 TTTGTCTGCCTTGGTGAAATTGG - Intronic
1118934353 14:70273034-70273056 TTTATTTACATTTTTAAAAAAGG - Intergenic
1120229179 14:81824038-81824060 TTTATCATCCTTTGTTAAAATGG + Intergenic
1121028624 14:90637582-90637604 TTTGTGTACATTTGCAAAATAGG - Intronic
1122017374 14:98807707-98807729 TGTGTCTTCATTTGTAAAATGGG + Intergenic
1124866544 15:33497571-33497593 TTTATCTGTCTTTTTAAAATTGG + Intronic
1125276099 15:37994036-37994058 TTAATCTAGTTTTATAAAATTGG + Intergenic
1125682001 15:41536792-41536814 ATTTTCTTCCTCTGTAAAATGGG + Intronic
1126568137 15:50121683-50121705 TTTAGCTACCTTTGTATAATGGG - Intronic
1127019748 15:54733198-54733220 TGTTTCTCCCTCTGTAAAATGGG - Intergenic
1127745687 15:61969684-61969706 TTTTTCTAATTTAGTAAAATAGG + Intronic
1128450209 15:67801646-67801668 TTTAGTTTCCTTTATAAAATGGG + Intronic
1128617190 15:69119401-69119423 ACTTTCTGCCTTTGTAAAATAGG + Intergenic
1128936945 15:71754848-71754870 TTTATCACCCTTTGTTAAAATGG - Intronic
1128993977 15:72283198-72283220 TTTATCTCCCCTTGGGAAATAGG + Intronic
1129511610 15:76127767-76127789 TTTAACTTCATTTGCAAAATAGG + Intronic
1129820315 15:78597013-78597035 TTTCACTAACTTTATAAAATTGG - Intronic
1130226187 15:82059809-82059831 GTTTTCTACTTTTGGAAAATGGG + Intergenic
1130675797 15:85950926-85950948 TGTTTCTTCCTCTGTAAAATGGG - Intergenic
1131163410 15:90124943-90124965 TTTATCATCATCTGTAAAATGGG + Intergenic
1131180324 15:90234604-90234626 TATTTCCATCTTTGTAAAATGGG - Intronic
1131559354 15:93425851-93425873 AGTTTCTACATTTGTAAAATGGG + Intergenic
1131610385 15:93955101-93955123 TTTATCTGCCTGTGTATAAAAGG + Intergenic
1131951661 15:97688106-97688128 TTTGTGTACCTTTATAAAACTGG - Intergenic
1133473863 16:6101101-6101123 ATTTTCTTCCTCTGTAAAATGGG + Intronic
1133669147 16:8000415-8000437 ATTCTCCACATTTGTAAAATGGG + Intergenic
1134811961 16:17175433-17175455 TTCATCTTCCTCTGTAAAATGGG - Intronic
1135184092 16:20299798-20299820 TGTTTCTCCCTTTGTAAAATGGG - Intergenic
1135468325 16:22706558-22706580 TTTATGTACCTTTGGAACAGTGG - Intergenic
1135610810 16:23865602-23865624 TATATCTATCTTTGTAGAAATGG + Intronic
1135661896 16:24304024-24304046 TTTATTTACTTTTTAAAAATGGG - Intronic
1135692515 16:24553544-24553566 TATATATACCTTTGTAAGCTGGG - Exonic
1136709751 16:32227234-32227256 TTCTTCTACCTTTGAGAAATTGG - Intergenic
1136758158 16:32702177-32702199 TTCTTCTACCTTTGAGAAATTGG + Intergenic
1136809949 16:33168198-33168220 TTCTTCTACCTTTGAGAAATTGG - Intergenic
1136816425 16:33278278-33278300 TTCTTCTACCTTTGAGAAATTGG - Intronic
1137326606 16:47444222-47444244 TTTATCTACTTTTATAAAATAGG + Intronic
1137513962 16:49126313-49126335 CATATCAACCTTTGTTAAATTGG + Intergenic
1139080594 16:63514359-63514381 TTTTTCTCAATTTGTAAAATGGG + Intergenic
1139216082 16:65124598-65124620 TTTAACTTACTTTTTAAAATCGG - Intronic
1140250706 16:73291934-73291956 TTTATTTACATTTGTAGAAATGG + Intergenic
1140302221 16:73769198-73769220 TTTAACTAGCTGTGTAAAGTTGG - Intergenic
1140428432 16:74880898-74880920 TTTATTTACTTTTGTGTAATAGG - Intronic
1140674934 16:77318937-77318959 TTTTTCTCCATTTGTAAAATGGG - Intronic
1140951934 16:79826647-79826669 GTTGTCTCCCTCTGTAAAATGGG - Intergenic
1203060309 16_KI270728v1_random:962526-962548 TTCTTCTACCTTTGAGAAATTGG + Intergenic
1144036303 17:11369009-11369031 ATTATCTTCATCTGTAAAATGGG - Intronic
1144466189 17:15499454-15499476 TTTTTCTACCTGGGTAAATTAGG - Intronic
1144508420 17:15854346-15854368 TTTATATACCTTTGTTAATGTGG - Intergenic
1144845800 17:18218287-18218309 AGTTTCTTCCTTTGTAAAATGGG + Intergenic
1147204338 17:38825768-38825790 TCTATTTAGCTTCGTAAAATAGG - Intergenic
1148581729 17:48748493-48748515 TTAATCTATCTTTAAAAAATAGG + Intergenic
1149880152 17:60281655-60281677 TTTTTCCTCCTTTGTAAAACAGG - Intronic
1149901061 17:60479290-60479312 TTTATCAAGTTTTCTAAAATTGG - Intronic
1149980529 17:61307537-61307559 GGTGTCTACCTGTGTAAAATAGG + Intronic
1150041477 17:61865959-61865981 ATTTTCTTCCTTTGTAAAATGGG - Exonic
1151492583 17:74441464-74441486 TGTTTCTCCATTTGTAAAATGGG + Intronic
1153181697 18:2442313-2442335 CTTTTCTCCCTCTGTAAAATGGG + Intergenic
1153330631 18:3869938-3869960 TATTTCTACATCTGTAAAATGGG - Intronic
1153795667 18:8619720-8619742 GTTGTCTTCCTTTATAAAATGGG + Intronic
1154356672 18:13626965-13626987 TTGATCTAGCTTTTAAAAATTGG + Intronic
1155052937 18:22164404-22164426 CTTTTCTACCTTTTTGAAATAGG - Intergenic
1155559263 18:27058125-27058147 TTTAAATAGCTTTGCAAAATAGG + Intronic
1155571793 18:27202673-27202695 TTTATTAACCTTTGGAAAATTGG + Intergenic
1155965181 18:32028894-32028916 TGTTTCTTCATTTGTAAAATGGG + Intronic
1156052800 18:32957934-32957956 TTTATCAACATTTTTAAATTAGG - Intronic
1156586935 18:38441557-38441579 TTTATCTTCTTTTGTTATATTGG - Intergenic
1156612331 18:38739649-38739671 TTTTTCTAACTTTGAGAAATGGG - Intergenic
1156900111 18:42290624-42290646 TTTTTTTACCTTTGTTTAATTGG - Intergenic
1157924910 18:51752908-51752930 TTTGTCTTCCTTTCTAAAACGGG + Intergenic
1158010409 18:52721565-52721587 TTTATCTTCCAATGTACAATGGG + Intronic
1158956410 18:62543981-62544003 TTTATCTACAAGTCTAAAATTGG - Intronic
1159013949 18:63086241-63086263 TTTATTAATGTTTGTAAAATAGG + Intergenic
1159324600 18:66898007-66898029 TTTTTCTAGTTTTGTAAGATGGG + Intergenic
1159329825 18:66977735-66977757 GTTTTCTCCCTATGTAAAATTGG - Intergenic
1160241176 18:77124326-77124348 TTTCTTGACCTTTGGAAAATTGG + Intronic
1160322891 18:77913204-77913226 ATTATCTGTCTTTATAAAATTGG + Intergenic
1161394088 19:4035480-4035502 TGTTTCTGCATTTGTAAAATGGG + Intronic
1161860441 19:6793816-6793838 TTTATCTCCATTTGAAAGATAGG - Intronic
1163074283 19:14875431-14875453 TCTTTCTACATTTGTAGAATTGG + Intergenic
1163947628 19:20554651-20554673 TTTATTTACTTTTTTAAAAGAGG - Intronic
1164392138 19:27833619-27833641 TTTATCCTTCTATGTAAAATTGG - Intergenic
1164890104 19:31816153-31816175 TTCTTCTGCCTTAGTAAAATTGG - Intergenic
1165381207 19:35481808-35481830 TTTATCACCCTTTGTTAAAACGG + Intergenic
1166884192 19:45949591-45949613 TTTTTCCACATCTGTAAAATGGG + Intronic
1167142137 19:47659153-47659175 TGTAACTACCTGTATAAAATAGG + Intronic
925157603 2:1659518-1659540 TTTATCTACCTTTTTATAAAAGG + Intronic
925450337 2:3963795-3963817 TTTCTGTGCCTTGGTAAAATTGG + Intergenic
925517980 2:4706280-4706302 TATATATACCTTTGTACTATAGG - Intergenic
925588388 2:5486030-5486052 TTTACCTAGCTTTGTGAAACTGG + Intergenic
926806031 2:16712090-16712112 TTTTTCTTCATTTGTGAAATAGG + Intergenic
927770067 2:25852857-25852879 TTTAATTAGCTTTGTAAATTCGG + Intronic
927771848 2:25869367-25869389 TTTTTGTACCTTTTTAAAATTGG - Intronic
928840001 2:35594464-35594486 CTCATGTACATTTGTAAAATGGG + Intergenic
929163327 2:38855464-38855486 TTTAGTAACATTTGTAAAATTGG + Intronic
929248215 2:39725438-39725460 TTTTTCTTCCTTTGTGATATTGG - Intergenic
930333107 2:50011595-50011617 TTTATATAATTTTATAAAATAGG + Intronic
931421650 2:62133603-62133625 TTTATCATCCTTTGTTAAAATGG - Intronic
931542891 2:63349646-63349668 TTTATATACCTTTTTTATATGGG - Intronic
931658658 2:64535548-64535570 TGTTTCTTCCTCTGTAAAATGGG + Intronic
932204564 2:69867594-69867616 TTTATGTTCCATCGTAAAATTGG + Intronic
932600024 2:73117280-73117302 TGTTTCCACCTCTGTAAAATGGG + Intronic
933005231 2:76983927-76983949 TTCATATACTTTTTTAAAATTGG + Intronic
935290339 2:101604820-101604842 TGTTTCTTCCTTCGTAAAATAGG - Intergenic
935434575 2:103015302-103015324 TTTATGAACCTTAATAAAATGGG + Intergenic
935525394 2:104160227-104160249 TTTATCTACATTTCTAAATTTGG + Intergenic
935655526 2:105419682-105419704 TTTATCACCCTTTGTTAAAATGG + Intronic
936000730 2:108827339-108827361 TTTTACTAGCTTTGTAAATTTGG - Intronic
937486502 2:122320703-122320725 TTTATCATCCTTTGTTAAAATGG + Intergenic
937897660 2:126990826-126990848 TTTATTTACCTTTGTTAAGATGG - Intergenic
938276286 2:130027488-130027510 TATTTCTCCATTTGTAAAATTGG + Intergenic
938327244 2:130418249-130418271 TATTTCTCCATTTGTAAAATTGG + Intergenic
938362695 2:130703228-130703250 TATTTCTCCATTTGTAAAATTGG - Intergenic
938439090 2:131309868-131309890 TATTTCTCCATTTGTAAAATTGG - Intronic
938494556 2:131786911-131786933 TTTATCTTCCTCTGCCAAATGGG + Intergenic
939340521 2:140889669-140889691 TGTTTCTTCCTGTGTAAAATGGG - Intronic
939537057 2:143444983-143445005 TTTATTTACATTAGGAAAATTGG - Intronic
940500745 2:154490378-154490400 TTTCTCTTCCTTGTTAAAATTGG + Intergenic
940534794 2:154926546-154926568 TTTTTCTACTTTTGTGAAAGTGG + Intergenic
940680470 2:156778915-156778937 ATTATATATCTTTGAAAAATTGG - Intergenic
941281472 2:163557089-163557111 ATTATCATCATTTGTAAAATGGG - Intergenic
942086429 2:172448442-172448464 TGTGTCCACATTTGTAAAATGGG + Intronic
942124317 2:172808709-172808731 AGTATCTTCATTTGTAAAATGGG - Intronic
942517086 2:176765760-176765782 TTTCTCTTCCGTTGTAAAAATGG + Intergenic
943439437 2:187908593-187908615 TTTATCTATTTTGGTAAATTTGG + Intergenic
944153505 2:196587580-196587602 CTTATCTAGTTTTGTGAAATGGG + Intronic
944157721 2:196625054-196625076 TTTATGTACTTTTGTATTATTGG - Intergenic
944199237 2:197087947-197087969 TTTATCCACCTCTGATAAATAGG + Intronic
944610141 2:201395106-201395128 ATTATTTCTCTTTGTAAAATGGG - Intronic
944692132 2:202168032-202168054 TTTTTCTTCCTCTGTAAAATGGG + Intronic
945096101 2:206221169-206221191 TTTATCACCCTTTGTTAAAATGG - Intergenic
945139633 2:206670751-206670773 TTTAACTTCTTTTGTGAAATTGG - Intronic
945202287 2:207294631-207294653 TTTCTGTGCCTCTGTAAAATGGG - Intergenic
945666107 2:212744869-212744891 TTTGTTTTCCTTTTTAAAATTGG - Intergenic
946176481 2:217925192-217925214 TTTATTTACATTTTTAAAAGGGG - Intronic
946545245 2:220733950-220733972 GTTATCTACCTTAAAAAAATAGG + Intergenic
947117522 2:226787633-226787655 ATTATCTGCTTTTGTCAAATAGG - Intronic
947410878 2:229838240-229838262 AATTTGTACCTTTGTAAAATGGG - Intronic
947807049 2:232976289-232976311 TGTGTCTTCCTTTGTGAAATGGG + Intronic
948650736 2:239441965-239441987 TGTTTCTTCCTGTGTAAAATAGG - Intergenic
949069379 2:242014394-242014416 TTTTTCTACCTTTTAAAAAGTGG + Intergenic
1168889141 20:1282816-1282838 TTTAACTTCATCTGTAAAATGGG - Intronic
1169287023 20:4317815-4317837 TTTATATATATTTGTAATATGGG + Intergenic
1169379394 20:5093846-5093868 TTTATATAGCTTTGATAAATGGG - Intronic
1169679641 20:8196458-8196480 TTTTTCTACCTCTGTAGAAATGG + Intronic
1169716060 20:8619657-8619679 TTTAACTAGCTTTGTAAATTAGG - Intronic
1169716081 20:8620012-8620034 TTTAACTAGCTTTGAAAATTAGG + Intronic
1170029141 20:11926082-11926104 TTTATTTACTTTTGTAATCTTGG + Exonic
1170291663 20:14776875-14776897 TTTATTTAAATTTGGAAAATAGG - Intronic
1170831593 20:19847049-19847071 TTTATCTCTTTTTGTAATATTGG + Intergenic
1172631031 20:36378260-36378282 TTTTTCTTCATCTGTAAAATGGG + Intronic
1172813512 20:37668729-37668751 TTTGTCTTCATCTGTAAAATAGG + Intergenic
1173167267 20:40694154-40694176 CTTACCTATCTCTGTAAAATAGG - Intergenic
1173453181 20:43183387-43183409 TTTTTCTGCATCTGTAAAATGGG - Intronic
1173915529 20:46705597-46705619 TTTATTTACAATTCTAAAATTGG + Intergenic
1175375226 20:58519482-58519504 TGTTTCTTCCTCTGTAAAATAGG + Intergenic
1175577745 20:60075270-60075292 TTCATCTTCCTTTTAAAAATTGG + Intergenic
1176613376 21:9007359-9007381 TTTATCTTCCTTTGCCAAATGGG - Intergenic
1176652460 21:9563447-9563469 TGTTTCTTCCTCTGTAAAATGGG - Intergenic
1176711801 21:10156434-10156456 TTTATCTTCCTTTGCCAAATGGG + Intergenic
1177240465 21:18449549-18449571 TTTATGTTCCTCTGTAAGATGGG + Intronic
1177309238 21:19366881-19366903 TCTATCTATCTATCTAAAATAGG - Intergenic
1178003897 21:28195089-28195111 TCTTTCTATCTTTTTAAAATAGG - Intergenic
1179604933 21:42508854-42508876 TTAAACTACCTGTATAAAATAGG - Intronic
1180059534 21:45377534-45377556 TTTATCACCCTTTGTTAAAATGG + Intergenic
1180459080 22:15542407-15542429 TATTTCTCCATTTGTAAAATGGG - Intergenic
1180498747 22:15912998-15913020 TTTACCTTCCTTTGCCAAATGGG + Intergenic
1181085046 22:20436092-20436114 TGTCTCCACCTCTGTAAAATGGG - Intronic
1181093391 22:20489592-20489614 TTTATCTCTCTTTTTAAAATTGG - Intronic
1181320258 22:21999246-21999268 TTAATCTGCCTTTTTAAAATAGG + Intergenic
1182183234 22:28373238-28373260 TTTTTCAACATTTGTAAAACAGG - Intronic
1182289196 22:29265750-29265772 TGTTTCCACCTCTGTAAAATAGG - Intronic
1182293405 22:29299181-29299203 TTTATCTTCCTTAGTTCAATTGG + Intronic
1182602118 22:31474012-31474034 TTTATATACCTATGTATTATTGG + Intronic
1182923376 22:34100638-34100660 ATTTTCTTCCTTTGTAAAACAGG - Intergenic
1183874723 22:40769951-40769973 ATTATCTCCCTTTATAAACTTGG - Exonic
949204795 3:1425071-1425093 TGTTTCTACATCTGTAAAATGGG - Intergenic
949294867 3:2509807-2509829 TTTCTCTACCTTTGGATAGTAGG + Intronic
949298259 3:2552400-2552422 TTTGTCTGCCCTTGTAAATTAGG + Intronic
949743058 3:7258601-7258623 ATTATCTACTTTTTAAAAATTGG - Intronic
949778035 3:7653852-7653874 TCTTTCTACATCTGTAAAATGGG - Intronic
950132882 3:10559573-10559595 TGGATCTACATCTGTAAAATAGG - Intronic
950186761 3:10950271-10950293 TGTTTCTTCCTCTGTAAAATAGG + Intergenic
950219348 3:11182771-11182793 TTTCTATACCTCTGTGAAATAGG - Intronic
950240051 3:11361182-11361204 TCCCTCTACCTTTGCAAAATAGG + Intronic
951051161 3:18095722-18095744 TGTTTCTTCATTTGTAAAATAGG + Intronic
952192304 3:31036539-31036561 TTTGTCTTCTTTTGAAAAATGGG - Intergenic
952355185 3:32577478-32577500 TTTATATAACTTGTTAAAATAGG - Intergenic
953100033 3:39815512-39815534 TCTAGCTACATTTTTAAAATTGG + Intronic
953126686 3:40097234-40097256 AGTTTCTGCCTTTGTAAAATGGG - Intronic
953896968 3:46810448-46810470 CATATCTTCCTTTGTCAAATGGG - Intronic
955302466 3:57795235-57795257 TTTATATCCTTTTGAAAAATTGG + Intronic
955688710 3:61569337-61569359 TTTTTCTTCCTCTGTGAAATGGG + Intronic
955779617 3:62470477-62470499 TTTTTCTCACTTTGTAGAATGGG - Intronic
956232617 3:67033907-67033929 TCTTTCCACCTTTGTAAAATAGG - Intergenic
956662865 3:71616536-71616558 TTTTTCTCCCTTTATGAAATAGG + Intergenic
957111455 3:75964648-75964670 TCTTTCTTCCTTGGTAAAATAGG - Intronic
957136803 3:76298676-76298698 TTTATCTCCATGTTTAAAATGGG + Intronic
957261789 3:77911113-77911135 AATTTCTACATTTGTAAAATAGG + Intergenic
957430913 3:80105191-80105213 GTTATATACCTTTTTAAAAATGG - Intergenic
958003452 3:87781499-87781521 TTTATATAGCTTTTTAAAATTGG - Intergenic
958677295 3:97282150-97282172 TTTATCAAGCTTTTTACAATAGG + Intronic
958921219 3:100107939-100107961 TGTTTCTACCTTTCTAACATCGG + Intronic
959098834 3:101987295-101987317 TTTAACTACCTTGGTGAACTAGG + Intergenic
959217536 3:103471403-103471425 TTTATCTAATTATGTAAAAAAGG - Intergenic
959260316 3:104070944-104070966 TTAGTCTACATTTTTAAAATTGG - Intergenic
959417534 3:106094811-106094833 TTTATTTAAAATTGTAAAATTGG + Intergenic
959567276 3:107845300-107845322 TTTATATACCTTTTAAAATTAGG + Intergenic
960082790 3:113558907-113558929 TTTATTTAACTTTGTAAACAAGG - Intronic
960119655 3:113934553-113934575 TTTATCTATTTTTGTAAAGATGG + Intronic
960261243 3:115571039-115571061 TTTATTTTACTTTTTAAAATTGG - Intergenic
960702082 3:120449233-120449255 TGTTTCTTCCTCTGTAAAATCGG + Intronic
960764060 3:121105993-121106015 TTTTTCTCACTTTGAAAAATGGG - Intronic
961017685 3:123480308-123480330 TGTTTCTTCCTCTGTAAAATGGG + Intergenic
961624504 3:128252354-128252376 TATTTCTTCCTTTGTAAAAGGGG + Intronic
961980841 3:131076460-131076482 TTTATCTGCCTTTCTTAAATGGG - Intronic
962457860 3:135581822-135581844 TTTATCATCCTTTGTTAAAATGG - Intergenic
962900399 3:139756547-139756569 TTTGTCTGGCTCTGTAAAATGGG - Intergenic
963167235 3:142217301-142217323 TTTTTCTTTCTTTTTAAAATGGG - Intronic
964713809 3:159700069-159700091 CTTTTCTACCTTAATAAAATGGG + Intronic
965488769 3:169311719-169311741 TTTCTCTAAATTTTTAAAATGGG + Intronic
965495863 3:169398356-169398378 TTTATCCAGGTTTTTAAAATGGG - Intronic
965837608 3:172868593-172868615 TTTGGCTACCTTAGAAAAATGGG - Intergenic
965936085 3:174114417-174114439 TTTATATGCCATTTTAAAATTGG - Intronic
966741090 3:183234649-183234671 TTCAAATACCTTTATAAAATAGG + Intronic
967260758 3:187639583-187639605 ATTTTCTACATCTGTAAAATGGG - Intergenic
968137737 3:196231149-196231171 TGTTTCTTCCTTTGTAAAATGGG - Intronic
969585043 4:8086781-8086803 TTTATCTATCTTTGAGAATTTGG - Intronic
970807062 4:20049343-20049365 CTTGTAAACCTTTGTAAAATTGG + Intergenic
970900779 4:21156743-21156765 TTTATATAAATTTGTAAAAGTGG + Intronic
970911540 4:21282521-21282543 TTTAAATACATTTTTAAAATTGG + Intronic
972520780 4:39853990-39854012 GGTATCTTCATTTGTAAAATGGG + Intronic
972614031 4:40681083-40681105 TTTATCTCCATCTATAAAATGGG - Intergenic
972713013 4:41617397-41617419 TGTACCCACCTTTATAAAATGGG + Intronic
972814857 4:42632852-42632874 ATTCTCTTCCTTTGTAAAATGGG + Intronic
973014908 4:45126036-45126058 ATAGTCTCCCTTTGTAAAATGGG - Intergenic
973284018 4:48395023-48395045 TTTACTTACCTGTGTAAAATGGG + Intronic
973810715 4:54567408-54567430 TGTTTCCACATTTGTAAAATAGG - Intergenic
973866730 4:55122020-55122042 TTTATATACGTTTTTAAAAAAGG - Intronic
974440662 4:61912304-61912326 ATAATCTATCTTTGAAAAATGGG + Intronic
974633041 4:64519929-64519951 TTTTACTACATTTGTCAAATAGG - Intergenic
974709087 4:65564693-65564715 TTTATCTACCCTTGTAACGTTGG - Intronic
975463285 4:74680007-74680029 TTTTTCTACTTTTTTAAAGTAGG + Intergenic
975493504 4:75013511-75013533 TTTTTCCACATCTGTAAAATGGG + Intronic
975788372 4:77919415-77919437 TATATATACCTCTGTAAAATGGG - Intronic
976009558 4:80471074-80471096 CAGATCTTCCTTTGTAAAATAGG - Intronic
977216381 4:94289223-94289245 TTTATATAGCTTTATAAAATTGG + Intronic
977315055 4:95435944-95435966 TTTATCTCACTATGCAAAATTGG - Intronic
977518311 4:98049786-98049808 TTTCTCTCTCTTTGTAATATTGG - Intronic
978931523 4:114319139-114319161 TCTTTCCTCCTTTGTAAAATGGG + Intergenic
978975852 4:114870878-114870900 GTTATATACCTTTGTGAACTTGG - Exonic
979066584 4:116144445-116144467 TTTGTCTACATTTGCAAACTTGG - Intergenic
979694221 4:123593681-123593703 TTTATATACCTTTTTAACAAAGG + Intergenic
980398838 4:132253130-132253152 TTTATCCACCTATATAAAATTGG + Intergenic
980511712 4:133799321-133799343 TTTATTTACCTTTAGAAAAAAGG - Intergenic
980644111 4:135619367-135619389 TTTATTTATTTTTCTAAAATTGG - Intergenic
980835398 4:138185835-138185857 TATATCTACCTTTCTAAATGTGG + Intronic
980851282 4:138385846-138385868 TCTATATCCCTTTGTAACATTGG + Intergenic
981499149 4:145429551-145429573 TGTATCTTCATTTGTAAAATGGG + Intergenic
981732370 4:147913002-147913024 TTTCTCTTCCTTTTAAAAATAGG - Intronic
982179280 4:152734661-152734683 TATATCTGCTTCTGTAAAATTGG - Intronic
985386578 4:189453868-189453890 TCTGTCTGCCTCTGTAAAATGGG + Intergenic
986275834 5:6274386-6274408 TTTGTCTGTCTTTGTACAATGGG - Intergenic
986973271 5:13362737-13362759 TTTGCCTACATTTGTAAAATGGG - Intergenic
987807797 5:22792613-22792635 TTTATCTGGCTTTGTAAAGCTGG - Intronic
988076028 5:26356223-26356245 TATTTCTACTTTTGTAATATGGG + Intergenic
988183061 5:27823285-27823307 TTTATTTACCTTTGCAGAATTGG - Intergenic
989017216 5:36952092-36952114 TTAATGTACCTTTGTGCAATAGG + Intronic
989552620 5:42753606-42753628 TTTATTTATTTTTGTAAAAGAGG - Intergenic
990047094 5:51446233-51446255 TTTATCTTCCTTTAGAGAATAGG + Intergenic
990247401 5:53876452-53876474 TTTATATACTTTTATAAAATGGG - Intergenic
990313825 5:54565676-54565698 TTTATGTACCTGTTTAAAAGGGG + Intergenic
990832706 5:59977527-59977549 TTTATGCAGCTTTGTTAAATGGG - Intronic
990954007 5:61325827-61325849 TTTATTTACCTGTGTTAACTAGG - Intergenic
991365490 5:65863560-65863582 TTTATCTACTTTTTTCAAATTGG + Intronic
991553156 5:67865583-67865605 TGTAAATACCATTGTAAAATAGG + Intergenic
991702151 5:69326400-69326422 CTTATCTACCTTGACAAAATAGG - Intronic
992047444 5:72908381-72908403 TTTATCCCCTTTTGCAAAATGGG - Intronic
993106280 5:83604590-83604612 TCTATCTATCTATCTAAAATTGG + Intergenic
993355468 5:86901606-86901628 TCTTGCTATCTTTGTAAAATTGG - Intergenic
993384290 5:87245477-87245499 TATATCTTCATCTGTAAAATGGG + Intergenic
993805085 5:92397225-92397247 TTTATAAAATTTTGTAAAATGGG + Intergenic
993998789 5:94753721-94753743 TGAAACTACCTTTTTAAAATGGG + Intronic
994059693 5:95460536-95460558 TTTATTTGAATTTGTAAAATAGG - Intergenic
994760183 5:103842296-103842318 TTTATCTATTTTTTTGAAATGGG + Intergenic
994942104 5:106337540-106337562 ATTTTCTACCTTTATAATATTGG + Intergenic
994942179 5:106338857-106338879 ATTTTCTACCTTTATAATATTGG + Intergenic
995216306 5:109599315-109599337 TTTCTCTTCCACTGTAAAATGGG + Intergenic
995950757 5:117710358-117710380 TTTTTTTTCCTTTTTAAAATTGG + Intergenic
996360544 5:122640549-122640571 TTTATCTTTCTTTAGAAAATTGG - Intergenic
996561323 5:124832661-124832683 TTTATCACCCTTTGTTAAAATGG - Intergenic
996717965 5:126602397-126602419 TTTGTCTACCTCTGTGGAATTGG + Intronic
997233783 5:132261034-132261056 TTTCTCTTCATCTGTAAAATAGG + Intronic
997827651 5:137121759-137121781 TTTATATACATATATAAAATAGG + Intronic
998218733 5:140257827-140257849 TTTAGCTACCATTGTAATAAGGG + Intronic
999337100 5:150730403-150730425 ATTTTCTACATTTGTAAAACAGG + Intronic
999540545 5:152567111-152567133 TTTAATTACCTTTGTAAATAAGG + Intergenic
1000170476 5:158698096-158698118 TTTATCAACTTTTGGAAGATAGG + Exonic
1001075402 5:168623460-168623482 TTTTTGTACCTTTTTAAATTGGG + Intergenic
1001196789 5:169680213-169680235 CTTTTCTTCATTTGTAAAATGGG + Intronic
1001867458 5:175117674-175117696 TTTACCTTCTTTTGAAAAATTGG + Intergenic
1002539823 5:179899071-179899093 AGTCTCCACCTTTGTAAAATGGG + Intronic
1003302769 6:4899418-4899440 TTTATCATCCTTTGTTAAAATGG - Intronic
1003672019 6:8168262-8168284 TTTATTTCCCTGTGTACAATGGG - Intergenic
1003806766 6:9734340-9734362 TTTATCTACTTTTCAAAAACAGG + Intronic
1004036463 6:11929097-11929119 TTTATTTTATTTTGTAAAATGGG + Intergenic
1004107414 6:12678588-12678610 TTTTTATTCCTTTGCAAAATTGG + Intergenic
1004183333 6:13399648-13399670 TTTATCTGCAATTGTAAAACAGG + Intronic
1005248640 6:23918236-23918258 CTAATCTACCATTGTAAAAATGG - Intergenic
1005476060 6:26209146-26209168 TTTTTCCACATTTGTAAAATAGG - Intergenic
1005483971 6:26281831-26281853 TTTTTCCACATTTGTAAAATAGG + Intergenic
1005591836 6:27336882-27336904 TTTTTCTGCCTCTTTAAAATTGG + Intergenic
1007123478 6:39402820-39402842 TTTATGTACATCTGTAAAGTTGG - Intronic
1008021939 6:46588998-46589020 TATCTCTACCTTAGTAAAGTTGG - Intronic
1008225638 6:48912287-48912309 TTTGTCTAGTTTTTTAAAATAGG - Intergenic
1008438102 6:51499616-51499638 ATTATATACCTTTCTAAAAGAGG - Intergenic
1008450488 6:51645044-51645066 TATATGTACCTTTTTATAATTGG - Intronic
1008715706 6:54287458-54287480 TTTATTTATCTTTGCAAATTCGG - Intergenic
1008764116 6:54890350-54890372 TTTTTCTATTTTTGTAAAACTGG + Intronic
1011422062 6:87183596-87183618 TTTATTTACATTTTTAAAAGGGG + Intronic
1011634295 6:89355709-89355731 ATTATCTTCATCTGTAAAATGGG - Intergenic
1011860078 6:91743632-91743654 TTGATCTGATTTTGTAAAATAGG + Intergenic
1011874218 6:91936913-91936935 TTTAAGTACCTCTGTACAATAGG - Intergenic
1011939607 6:92826420-92826442 TTTATCTGACTTGGTCAAATTGG + Intergenic
1013755144 6:113452829-113452851 TATATATACCTTTATAAGATTGG + Intergenic
1013951299 6:115785280-115785302 TTTTTATCACTTTGTAAAATGGG + Intergenic
1013979454 6:116112488-116112510 TTTGTATACCTTTAAAAAATAGG - Intronic
1014605158 6:123464502-123464524 TTTTCCTAGCTTTGTAAATTTGG - Intronic
1014977745 6:127909897-127909919 ATTATCTTAGTTTGTAAAATAGG - Intronic
1015020132 6:128463176-128463198 TTTATCTGCATTTGTCATATAGG - Intronic
1015560251 6:134507296-134507318 TTTACCTACCTTTTTAAGGTAGG + Intergenic
1015581735 6:134732217-134732239 TTTATTTACATTTTTAAAAAGGG + Intergenic
1015870099 6:137767628-137767650 TTTATCATCCTTTGTTAAAATGG + Intergenic
1015990359 6:138935405-138935427 TTTAGCTATCTTTGGATAATAGG - Intronic
1016349302 6:143149868-143149890 ATTAGCTACCTTTAAAAAATTGG + Intronic
1016739519 6:147512689-147512711 GATTTCTACCTTTGTGAAATGGG + Intronic
1017173918 6:151483927-151483949 TTTCTTTACTTTTGGAAAATAGG - Intergenic
1018217121 6:161539273-161539295 TTAATTTACCTTCGCAAAATAGG - Intronic
1019127163 6:169848412-169848434 TATTTCTACTTTTGTTAAATTGG - Intergenic
1020174388 7:5870627-5870649 TTTATCTTCATCTGTAAAATAGG + Intergenic
1020382277 7:7559784-7559806 CTTATCTACCATGATAAAATAGG + Intergenic
1020678133 7:11204122-11204144 TCTCTCTACCTCTGTAAAATGGG + Intergenic
1021422254 7:20459007-20459029 TTCATCTATTTTTTTAAAATGGG + Intergenic
1021641892 7:22745682-22745704 TTTATCTAATTTTGTAAACTAGG + Intergenic
1022456957 7:30565923-30565945 TTAATCTCCCTTTGGAACATGGG + Intergenic
1022735682 7:33073736-33073758 TTTATATACATTAGTAAAAGAGG - Intergenic
1023023174 7:36028823-36028845 TTTACCTGCCTTTGTATACTGGG - Intergenic
1023477499 7:40596614-40596636 TTTATATATCTTTGGAAACTTGG + Intronic
1023666866 7:42532258-42532280 TTTATCCACCATTGTCAAGTTGG + Intergenic
1024049347 7:45609050-45609072 TTGTTCTCCCATTGTAAAATGGG + Intronic
1024671858 7:51602989-51603011 TTCTTCTGCCTTTCTAAAATGGG + Intergenic
1024868025 7:53926148-53926170 TTTATCTACTGTTTTAAATTGGG + Intergenic
1026003606 7:66582606-66582628 TTTATTTTCCCTTGTAAAGTTGG - Intergenic
1026027671 7:66760410-66760432 TTTATTTTCCCTTGTAAAGTTGG + Intronic
1026236541 7:68532136-68532158 TTTGTCTACCTTTGTAAAAAGGG - Intergenic
1026450806 7:70527615-70527637 TTTATCTCCCTTTTTAACAAAGG - Intronic
1027306210 7:76900125-76900147 TTTATCTACCTCTGTCTCATAGG + Intergenic
1027379504 7:77591479-77591501 TTTCTATACCTGTTTAAAATAGG + Intronic
1027567286 7:79811661-79811683 TTTCTCTACCTCTTAAAAATAGG + Intergenic
1027580547 7:79989298-79989320 TTTATCTACTTTTTAAAAATTGG + Intergenic
1028147146 7:87330639-87330661 TTTGTTTAACTTTTTAAAATGGG + Intergenic
1028577350 7:92366756-92366778 GGTATCTCCCTCTGTAAAATCGG - Intronic
1028641364 7:93045201-93045223 TTTATTTACTTTTGTAAAATGGG + Intergenic
1028929834 7:96400412-96400434 TTTATTTACATTCTTAAAATGGG + Intergenic
1029084368 7:97999734-97999756 TTTATCTTCATCTGTAAAATGGG - Intergenic
1030096307 7:105903254-105903276 AGTTTCTTCCTTTGTAAAATGGG + Intronic
1030247673 7:107402552-107402574 TTTAACTAGCTTTCAAAAATAGG - Intronic
1032353921 7:131191609-131191631 TTTCTCTCTCCTTGTAAAATTGG - Intronic
1032730346 7:134635939-134635961 TTTCTCAGCCTTTATAAAATTGG + Intergenic
1033826510 7:145197084-145197106 TTTATTTACTTTTAAAAAATCGG + Intergenic
1033894581 7:146054940-146054962 TTTCTTTATCTTTGGAAAATTGG + Intergenic
1034889130 7:154824207-154824229 GTTATCTACTTTTGAAATATGGG - Intronic
1035790679 8:2301536-2301558 TTTTTCCACTTGTGTAAAATTGG - Intergenic
1035802126 8:2420169-2420191 TTTTTCCACTTGTGTAAAATTGG + Intergenic
1035940266 8:3892198-3892220 TTAATTTAACCTTGTAAAATAGG - Intronic
1036807949 8:11847980-11848002 TTTATTTGCCTTTATAAACTGGG - Intronic
1038698577 8:29828322-29828344 TTTGTATACCTATGTAAAATAGG - Intergenic
1038802886 8:30765277-30765299 TTTATTTATTTTTGTAAGATTGG + Intronic
1039979799 8:42399415-42399437 TTTATGTAACTTGCTAAAATAGG + Intronic
1040895309 8:52362278-52362300 TTTATCTACCTTTAAAAATATGG - Intronic
1040974884 8:53178924-53178946 TTTATTTCTATTTGTAAAATGGG + Intergenic
1041335678 8:56779927-56779949 TTCACATACCTTTGGAAAATAGG + Intergenic
1041393209 8:57366272-57366294 TATTTCTTCATTTGTAAAATGGG - Intergenic
1041702183 8:60803421-60803443 TTTAGCTACCTTTTAAAAATAGG + Intronic
1042460747 8:69064034-69064056 CTTATTGACATTTGTAAAATGGG + Intergenic
1042704967 8:71656608-71656630 TTTATCTAGCTTTTTACACTTGG - Intergenic
1043374611 8:79634679-79634701 TATATCCTCATTTGTAAAATTGG + Intronic
1043642819 8:82478266-82478288 TCTTTCTGCCTTTGAAAAATTGG + Intergenic
1043984284 8:86675371-86675393 TTTATCAAAATTTGTAGAATTGG - Intronic
1044034783 8:87287281-87287303 TTTAGCAACCCTTGTTAAATTGG - Intronic
1044640855 8:94379931-94379953 TATATCTTCATCTGTAAAATGGG + Intronic
1044847930 8:96399832-96399854 TTTAACCTCATTTGTAAAATGGG - Intergenic
1045000293 8:97872356-97872378 TTTATCTACTTATGGAAAGTGGG + Intronic
1045518628 8:102883589-102883611 TTCATGTACCTTGGTCAAATAGG + Intronic
1045763327 8:105636935-105636957 TTTATCTACCTTTGTAAAATGGG - Intronic
1045822158 8:106351887-106351909 TATTTCTTCATTTGTAAAATAGG - Intronic
1046702198 8:117414156-117414178 ATTATCTTCCTTTGTAAAGGAGG - Intergenic
1046942154 8:119941738-119941760 TTATTCTCCCTTTGGAAAATAGG + Intronic
1047176170 8:122542526-122542548 TTTTTCTGCCTTTGCATAATTGG - Intergenic
1047481871 8:125291394-125291416 TTTATCTTCCATTTTTAAATTGG + Intronic
1047682640 8:127270136-127270158 AATTTCTACATTTGTAAAATGGG - Intergenic
1048291263 8:133183364-133183386 TGTTTCTGCCTCTGTAAAATGGG + Intergenic
1048405975 8:134121601-134121623 TTTTTCTAACTTTTTAAAGTGGG - Intergenic
1050252339 9:3758039-3758061 TTTATCACCCTTTGTAAAAATGG + Intergenic
1051028136 9:12638985-12639007 TTTATGTACCTTTCCAAAATGGG + Intergenic
1051552783 9:18349000-18349022 TTTCTCCAACTTTGAAAAATAGG - Intergenic
1051807700 9:21014162-21014184 TTTTTTTTCCTCTGTAAAATGGG - Intronic
1051866600 9:21690164-21690186 TTTTTCTACCTTTTTAATAAGGG - Intergenic
1052946289 9:34170996-34171018 TTTATTAAGCTTTTTAAAATGGG - Intergenic
1053404043 9:37855581-37855603 TTCATCTACCTTTGGGAAAGAGG + Intronic
1053648794 9:40142122-40142144 TTTATCTTCCTTTGCCAAATGGG + Intergenic
1053756950 9:41321720-41321742 TTTATCTTCCTTTGCCAAATGGG - Intergenic
1054329775 9:63740063-63740085 TTTATCTTCCTTTGCCAAATGGG + Intergenic
1054535788 9:66234048-66234070 TTTATCTTCCTTTGCCAAATGGG - Intergenic
1054746661 9:68860713-68860735 TAAATCCACCTCTGTAAAATGGG + Intronic
1054880278 9:70137285-70137307 TTTATCTACCATTTAAGAATAGG + Intronic
1055522765 9:77098307-77098329 TTTGTGTATCTTTTTAAAATGGG + Intergenic
1055617887 9:78092143-78092165 TTTATTTACCCTTTAAAAATAGG + Intergenic
1055820737 9:80259435-80259457 TTTATCTTCATTTGAATAATAGG - Intergenic
1056057448 9:82841548-82841570 TTTTATTACCTTTCTAAAATTGG + Intergenic
1056282969 9:85060398-85060420 TTTGTCTGCCTTTTCAAAATAGG + Intergenic
1057602365 9:96469934-96469956 TTTATATTCATTTATAAAATAGG + Intronic
1057745387 9:97746981-97747003 TTTAGTTACGTTTTTAAAATTGG - Intergenic
1057897144 9:98918114-98918136 CTTTTCTCCTTTTGTAAAATGGG - Intergenic
1058204141 9:102081871-102081893 TATTTCTTCCTTTTTAAAATAGG - Intergenic
1058481954 9:105404842-105404864 AGGATCTTCCTTTGTAAAATGGG + Intronic
1058931845 9:109728281-109728303 TGTTTCTACATCTGTAAAATGGG - Intronic
1059535189 9:115074013-115074035 TCTTTTTACTTTTGTAAAATAGG + Intronic
1059823439 9:117999609-117999631 TTCTTCTACTTTTGTAAAGTGGG + Intergenic
1060115827 9:120939537-120939559 TATATTTGCTTTTGTAAAATGGG + Intergenic
1060471986 9:123955797-123955819 CTTAACTTCCTCTGTAAAATGGG - Intergenic
1060536283 9:124391201-124391223 TTATTCTCCTTTTGTAAAATGGG - Intronic
1061311115 9:129763255-129763277 TTTATCTCCCTCTGTAACATGGG - Intergenic
1061819618 9:133219440-133219462 TTCATTTCCCTTTTTAAAATTGG - Intergenic
1062241021 9:135538445-135538467 TTCATTTCCCTTTTTAAAATCGG + Intergenic
1202796556 9_KI270719v1_random:125423-125445 TTTATCTTCCTTTGCCAAATGGG + Intergenic
1186047149 X:5548804-5548826 TTTTTCTCCTTTTGTGAAATAGG + Intergenic
1186330829 X:8531467-8531489 TTTACCTACCTAAGTAAAACAGG - Exonic
1186400698 X:9256803-9256825 TTTATCTATCTATCTAAATTAGG - Intergenic
1186549765 X:10491194-10491216 TTTAACAACCTTTTAAAAATGGG + Intronic
1187196152 X:17086657-17086679 TTTTTCTACCTTTATTAATTGGG + Intronic
1187388847 X:18872738-18872760 TGTCTCTTCCTGTGTAAAATAGG - Intergenic
1187781884 X:22836383-22836405 TTTGCCTGTCTTTGTAAAATCGG - Intergenic
1188505247 X:30875487-30875509 TATATCTGCCCTTGTGAAATAGG - Intronic
1189264560 X:39703768-39703790 TTTCTCTATCTTTTTAAAATAGG - Intergenic
1189523303 X:41793255-41793277 AGTTTCTACCTCTGTAAAATGGG - Intronic
1190119464 X:47648790-47648812 TTTTTCTTCATTTGTGAAATGGG - Intronic
1190586991 X:51955087-51955109 TACATCTACTTTTTTAAAATTGG - Intergenic
1190717739 X:53118147-53118169 TCTATATACCTTAGAAAAATGGG - Intergenic
1191901189 X:66042132-66042154 TTTAGACACATTTGTAAAATGGG - Intergenic
1193334759 X:80274738-80274760 TTTATCTACCTTTGTTTTTTTGG - Intergenic
1194974436 X:100379404-100379426 TTTGCCCACCTTTATAAAATAGG + Intronic
1195404246 X:104495408-104495430 TTTTTCTACTTTGGTTAAATTGG + Intergenic
1195976960 X:110537139-110537161 TTTTTTTTCCTTTGTACAATTGG + Intergenic
1196102464 X:111861696-111861718 TTTAAATACCTGGGTAAAATCGG + Intronic
1196207300 X:112955445-112955467 AGTCTCTGCCTTTGTAAAATGGG + Intergenic
1196494552 X:116308850-116308872 TTTAGTTACCTTTATAAAGTAGG + Intergenic
1196642951 X:118084853-118084875 TTTTTCTATTTTTGTAGAATGGG - Intronic
1197626327 X:128806166-128806188 TTTATCTATAGTTGTAAAATGGG + Intergenic
1197634045 X:128894088-128894110 TTTATTTACATTTATAAAACAGG + Intergenic
1197841799 X:130756021-130756043 TTTTTGTTCCTTTGTAACATAGG - Intronic
1198641449 X:138760468-138760490 CTTCTCTAACTTTGTAAAGTGGG - Intronic
1198673972 X:139112095-139112117 TTTTTCTGTCTTTGTAAAATAGG - Intronic
1198834748 X:140793145-140793167 TTTATATACTTTTGTGCAATTGG + Intergenic
1199114864 X:143979444-143979466 TTTATCTATCTGGGTAAATTTGG - Intergenic
1199272597 X:145901722-145901744 TCTATCAATCTTTGTAAAACTGG - Intergenic
1199721607 X:150546686-150546708 TTTATCTGCATTTATAAAACAGG - Intergenic
1201867099 Y:18667578-18667600 TTTATCCCCCTTTTTAAAACTGG - Intergenic