ID: 1045763329

View in Genome Browser
Species Human (GRCh38)
Location 8:105636948-105636970
Sequence GGTAGATAAAAGACTTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045763324_1045763329 14 Left 1045763324 8:105636911-105636933 CCTATGAGATAATCAACATACTA 0: 1
1: 0
2: 0
3: 10
4: 188
Right 1045763329 8:105636948-105636970 GGTAGATAAAAGACTTAAGTAGG No data
1045763326_1045763329 -9 Left 1045763326 8:105636934-105636956 CCCCATTTTACAAAGGTAGATAA 0: 1
1: 0
2: 6
3: 87
4: 784
Right 1045763329 8:105636948-105636970 GGTAGATAAAAGACTTAAGTAGG No data
1045763327_1045763329 -10 Left 1045763327 8:105636935-105636957 CCCATTTTACAAAGGTAGATAAA 0: 1
1: 0
2: 4
3: 69
4: 575
Right 1045763329 8:105636948-105636970 GGTAGATAAAAGACTTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045763329 Original CRISPR GGTAGATAAAAGACTTAAGT AGG Intronic
No off target data available for this crispr