ID: 1045763555

View in Genome Browser
Species Human (GRCh38)
Location 8:105639739-105639761
Sequence ATGAAGCCAGGCCTCCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045763553_1045763555 12 Left 1045763553 8:105639704-105639726 CCTTGTGGTCATAAGTCAGTACA 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1045763555 8:105639739-105639761 ATGAAGCCAGGCCTCCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045763555 Original CRISPR ATGAAGCCAGGCCTCCATGT TGG Intronic
No off target data available for this crispr