ID: 1045764703

View in Genome Browser
Species Human (GRCh38)
Location 8:105653345-105653367
Sequence ATTCTCTACCTGGCATATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045764703 Original CRISPR ATTCTCTACCTGGCATATAG TGG (reversed) Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
906365697 1:45207356-45207378 ATCCTCTGCCTGGCACATAGTGG + Intronic
908261780 1:62344719-62344741 AAGCTCTGCCTGGCACATAGTGG - Intergenic
923365938 1:233261410-233261432 ATTTTCTAAATGGCATGTAGGGG + Intronic
1067978767 10:51057205-51057227 ATTCTATACCTGACATTTTGAGG + Intronic
1068749400 10:60574134-60574156 ATTTTTTACCTAGCATATAAAGG + Intronic
1069295325 10:66836652-66836674 ATTCGCTACATGCCACATAGTGG - Intronic
1071341702 10:84654766-84654788 AATCTCTACCTGTGATAAAGAGG - Intergenic
1073023230 10:100464956-100464978 TTTCTCTGCATGGCATAAAGGGG - Intronic
1073649889 10:105347106-105347128 ATTCTCTAGCTGCTATATAAGGG + Intergenic
1078076546 11:8167167-8167189 CTTCAGTACCTGGCATATAATGG - Intronic
1080811680 11:35710684-35710706 CTTCTCTTCCTGGTATAGAGAGG + Intronic
1081183328 11:40012032-40012054 ATTCACTCCCTGTCATTTAGTGG - Intergenic
1081330679 11:41796117-41796139 AGTCTCTCCCTGCCATGTAGAGG - Intergenic
1081336561 11:41874128-41874150 ATTATCAACCTGGCATATGCAGG + Intergenic
1083825006 11:65196120-65196142 ATTCTTTACCTGGCCTAAACAGG - Intronic
1083851237 11:65368530-65368552 AAACTCTAGCTGGCATACAGAGG - Intergenic
1086583740 11:88428572-88428594 ATTCTCTACCTAGCACATAAGGG + Intergenic
1089553627 11:119301694-119301716 CTTCTCTACATGGCATAAAGCGG + Exonic
1089906125 11:122040579-122040601 ATTTTCTACCTGGCAGAAATCGG - Intergenic
1091735676 12:2919401-2919423 ATTCAATAGCTTGCATATAGAGG - Intronic
1095317446 12:40782736-40782758 ATTCTCTACCTGAAAAATAATGG + Intronic
1095466509 12:42492898-42492920 ATACTTTACCTGGCATCTAGGGG + Intronic
1097185940 12:57196419-57196441 GCTCTCTACCTGCCAGATAGAGG - Intronic
1098549219 12:71744919-71744941 ATTCTATACATGGGATATAATGG + Intergenic
1099621582 12:85008459-85008481 ATTCTTTACCTGACAAATTGTGG - Intergenic
1100044911 12:90367870-90367892 ATTCTCTACCTGGCTTATGTGGG + Intergenic
1101551530 12:105766908-105766930 ATTACAAACCTGGCATATAGTGG + Intergenic
1105979723 13:25506344-25506366 ATTCTATACCTTGCATAAATAGG - Intronic
1108472476 13:50781376-50781398 ATTCTCTTACTGGTATACAGTGG - Intronic
1109518645 13:63478038-63478060 TTTGTCTACATGACATATAGTGG - Intergenic
1110265840 13:73536579-73536601 ATTCTCTGCCTGGCATTTGTTGG - Intergenic
1113090776 13:106615761-106615783 TTTCTCTACCTTGTATATATTGG - Intergenic
1113216392 13:108045636-108045658 TTTCTTTACCTGAAATATAGTGG + Intergenic
1113313477 13:109154982-109155004 ATTCTGTCCCTGCCATAAAGGGG - Intronic
1114636501 14:24190056-24190078 ATTCTTTGCCTGGCACAAAGAGG + Intronic
1115513999 14:34167095-34167117 ATTCTCTACCAGCCACACAGAGG - Intronic
1117113396 14:52483448-52483470 ATTCTCTACCTGGCAGACTTTGG - Intronic
1120444073 14:84571499-84571521 ATTCTTTGCCTGGAATCTAGTGG + Intergenic
1126691580 15:51292905-51292927 ATTCTCTGCTTGGCATTGAGGGG + Intronic
1128707352 15:69846594-69846616 ATGCAGTGCCTGGCATATAGTGG + Intergenic
1133939457 16:10296232-10296254 ATTCTCTACTTTGCTTCTAGAGG - Intergenic
1137587911 16:49675232-49675254 AGCTTATACCTGGCATATAGTGG - Intronic
1137865161 16:51887083-51887105 AGTCTGTACCTGGTATATACAGG - Intergenic
1139860129 16:70013629-70013651 ATTCTCCACCTGGCAGAGTGAGG - Intergenic
1140579442 16:76211822-76211844 ATTTTATACCTGGAATAAAGAGG - Intergenic
1140655434 16:77134850-77134872 ATTCTTTACCTGGCTTACAAAGG + Intergenic
1140804148 16:78517558-78517580 ATTCTGTAACTGTCATATTGTGG + Intronic
1140935901 16:79669976-79669998 TTTCTCAACTTGGCATATGGTGG + Intergenic
1144364087 17:14525382-14525404 ATGCTCTACTTGGCATTTATAGG + Intergenic
1147919832 17:43909025-43909047 ATTTTCTAGCTTGCAGATAGAGG - Intronic
1152215433 17:79029063-79029085 ATACCATACCTGGCATGTAGTGG + Intronic
1154971005 18:21409719-21409741 ATACTGTACCTGACATATATTGG + Intronic
1155880455 18:31141505-31141527 AATGGCTACCTGGAATATAGGGG + Intronic
1157558301 18:48627923-48627945 ATTCTCTACATAGCATTCAGAGG - Intronic
1158303705 18:56081450-56081472 ATTCTCTACTTGGCATAAGAGGG - Intergenic
1159831352 18:73281680-73281702 ATTTTCTTACAGGCATATAGTGG + Intergenic
1159911891 18:74153091-74153113 ATTCTCTACCCCTCCTATAGTGG - Intronic
1162830778 19:13282944-13282966 ATTCTCTACATGGAATAGGGGGG - Intronic
1165217735 19:34288575-34288597 TTTCTCTACCTCTCATATAGTGG + Intronic
1165636148 19:37341854-37341876 ATTCCCTACCTAACATACAGTGG + Intronic
1166176958 19:41081021-41081043 ATTCTTTATCTGGCATATTGAGG + Intergenic
1166907339 19:46120585-46120607 ATTCTTTATCTGGCATTTTGAGG - Intronic
925328777 2:3042585-3042607 TGTCTCTACCTGGGATAAAGGGG - Intergenic
928888289 2:36175309-36175331 ATTCCCTACCTCTCAAATAGTGG - Intergenic
930663305 2:54077389-54077411 ACTCTCTGCCTAGCATATATAGG + Intronic
936493750 2:112999227-112999249 AGTCTCAACCTGGCACATTGGGG + Intergenic
937766698 2:125669604-125669626 ATTGTCTTCCTTGCTTATAGAGG - Intergenic
940613611 2:156022731-156022753 ATTGTCTTGCTGGCATCTAGCGG - Intergenic
943073857 2:183172163-183172185 ATTGCCTACCTGGCTTCTAGTGG + Intergenic
945697852 2:213130747-213130769 AATATCTAACTGGCATATATAGG - Intronic
946320044 2:218947807-218947829 GTTCACTGCCTGGCATGTAGAGG + Intergenic
946549903 2:220789840-220789862 ATTTTCTACCTGAGATTTAGTGG - Intergenic
1169059312 20:2649775-2649797 ATGGTGTACCTGGCATGTAGTGG - Intergenic
1172834008 20:37861182-37861204 AGTCTGTACCTGGCACACAGCGG + Intronic
1172906332 20:38372680-38372702 GCTCTCTGCTTGGCATATAGTGG + Intronic
1174781036 20:53388933-53388955 ATATTGTACCTGGCATGTAGTGG - Intronic
1178047006 21:28706550-28706572 TTTCTCTACCTGAAATATTGAGG + Intergenic
1179043361 21:37824479-37824501 GTTCTCTCCCAGGCATCTAGGGG + Intronic
1181734509 22:24871129-24871151 GTTCGCTACTTGGCATCTAGTGG - Intronic
1182849375 22:33458929-33458951 ATACTATACCTGGTATCTAGTGG - Intronic
1183069088 22:35383829-35383851 AATCAGTACCTGGCATATAGTGG - Intronic
1183811298 22:40259930-40259952 AAAATCTACCTGGCAAATAGAGG - Intronic
1184908118 22:47505640-47505662 GTTCTCTACCTTGATTATAGTGG + Intergenic
949769024 3:7558280-7558302 ATTTAATACCTGGCATAGAGTGG + Intronic
952076756 3:29706154-29706176 ATTCTCTTCCTGACATCAAGTGG - Intronic
952176600 3:30870586-30870608 ATTCTCTACACGGCATCCAGAGG - Intronic
952232895 3:31449339-31449361 ATTCTTTATCTGGCATTTTGAGG - Intergenic
956690758 3:71875898-71875920 ATTCCCTACCTGGCCCCTAGAGG - Intergenic
957422467 3:79989054-79989076 GTTCTCTTCCTGGCATTTAAAGG - Intergenic
958446838 3:94226069-94226091 CTGCTATATCTGGCATATAGGGG - Intergenic
964903803 3:161693537-161693559 ACTCTCTATCTAGCTTATAGTGG + Intergenic
965600785 3:170452740-170452762 TCTCTCTACATGGCATATATAGG - Intronic
966129382 3:176619985-176620007 ATTTTCTAGCTGCCAAATAGAGG + Intergenic
967391213 3:188956674-188956696 TTTCTCTAGCTGTCAAATAGGGG - Intronic
970721403 4:18993436-18993458 CTTCTCTTCCTGGTATAGAGAGG + Intergenic
970931109 4:21513088-21513110 TTTCTCTGCCTGGAACATAGTGG - Intronic
971095826 4:23401199-23401221 ATTTTCTACCTGGCTAATATTGG + Intergenic
971950486 4:33339483-33339505 ATTCTTTATGTGGCATTTAGAGG + Intergenic
975757718 4:77587585-77587607 GTACTGTACCTGGCATACAGTGG - Intronic
976619397 4:87113004-87113026 CTACTCTATCTTGCATATAGTGG - Intronic
977936744 4:102814672-102814694 AATCACTACCTGGCACATAATGG + Intronic
978623525 4:110658707-110658729 CTACTCTAGCTGGCATATTGGGG + Intergenic
979173246 4:117627860-117627882 ACTCCCTTCCTGGCATGTAGAGG - Intergenic
980792862 4:137642211-137642233 TTTCTCTACATGGCACATAAAGG + Intergenic
984646307 4:182224367-182224389 ATTCTTTTCCTGGCATGTATTGG + Intronic
984750489 4:183268224-183268246 ATTCTCTTCCTGGGATTTAAAGG + Intronic
986495475 5:8337641-8337663 ATATACTACCTGGCACATAGTGG + Intergenic
988260275 5:28877339-28877361 CTTCTCTACATGTCATATACTGG + Intergenic
990350781 5:54913739-54913761 ATTTTCTACCTGGAATACAATGG - Intergenic
996595357 5:125195459-125195481 ATTCTATACCTAGCATATTATGG + Intergenic
996955290 5:129176169-129176191 ATTCTCAACCTTGCTTATAAAGG + Intergenic
997563367 5:134867998-134868020 ATTCTGCACCTGGCATAATGAGG - Intergenic
998566585 5:143221307-143221329 ATTTTCAAACTGGTATATAGAGG + Intronic
1001089733 5:168728475-168728497 ATTCTTTACCTGGCATTTCAAGG - Intronic
1001170613 5:169415844-169415866 ATTCTCCACCTGTCATACTGGGG - Intergenic
1004218611 6:13725425-13725447 ATTATCTACCTGGCTCATGGAGG - Intergenic
1004523896 6:16387856-16387878 GTACACTACCTGGCATGTAGTGG - Intronic
1005991178 6:30903295-30903317 TTTCAATACCTGGTATATAGTGG - Intergenic
1008831390 6:55766987-55767009 ATGCTGTGCCTGGCATATAATGG + Intronic
1011287022 6:85735835-85735857 ATTCTCTGCCTGGCATTTGCTGG - Intergenic
1011762655 6:90586020-90586042 CTTCAGTACCTGGCATGTAGGGG - Intronic
1015748684 6:136538351-136538373 CTTCTCTACCAGGAAAATAGAGG - Intronic
1016900721 6:149098062-149098084 ATTCTTTATCTGGCATTTTGGGG - Intergenic
1017456186 6:154603593-154603615 ACTCTCTTCCAGGCAGATAGAGG + Intergenic
1017608385 6:156157658-156157680 ATTATCTACTTGGCAGAGAGGGG - Intergenic
1019867604 7:3727473-3727495 ATTCTCTCCCTGGCAAAAAGAGG - Intronic
1021825810 7:24550087-24550109 ATTCTCTAGCTGGGATCTTGTGG + Intergenic
1023660413 7:42466021-42466043 CTTCTCTGCCTGGCATTCAGTGG - Intergenic
1025147339 7:56516232-56516254 ATTCTCTACCTGGCTTCTCTAGG - Intergenic
1025940802 7:66075373-66075395 TCTCTGTACCTGGCACATAGAGG + Intergenic
1027336536 7:77156814-77156836 ATTCTGAGCCTGTCATATAGTGG + Intronic
1027754887 7:82201110-82201132 ATACCCTACCTGGTATCTAGTGG - Intronic
1028523672 7:91759600-91759622 GCTCTCTCCCAGGCATATAGGGG - Intronic
1029779255 7:102714295-102714317 ATTCTGAGCCTGTCATATAGTGG - Intergenic
1031700787 7:124923180-124923202 ATTCTTTATCTGGCATTTCGAGG - Intronic
1038043278 8:23744823-23744845 ACTCTCTACCTGGCCTAGGGAGG + Intergenic
1039626026 8:39054109-39054131 ATTCTCTTCCTGGCTTGCAGAGG - Intronic
1042572667 8:70183856-70183878 ATTTGCTGCCTGGCACATAGTGG + Intronic
1042870797 8:73397225-73397247 ATGCTCTAACTGACATATATAGG + Intergenic
1043394704 8:79825265-79825287 CTTCCCTACCTGGCAGAAAGGGG + Intergenic
1045344540 8:101282467-101282489 GATCTCTACCTGGCACACAGTGG + Intergenic
1045764703 8:105653345-105653367 ATTCTCTACCTGGCATATAGTGG - Intronic
1045906855 8:107355944-107355966 TTTCACTGCCTGGCACATAGTGG + Intronic
1048225764 8:132583920-132583942 CTTCTCTACACTGCATATAGGGG - Intronic
1051671918 9:19519174-19519196 AATCTATGCCTGGCATAGAGAGG - Intronic
1055026358 9:71726519-71726541 ACTGTATACCTGGCATATAGTGG - Intronic
1056642067 9:88379974-88379996 CTTTTCTTCCTGGCATAGAGAGG + Intergenic
1061152962 9:128839270-128839292 TTTTTCTACCTGTCAAATAGTGG - Intronic
1188244346 X:27822212-27822234 ATTCTCAAACTGGTATACAGAGG + Exonic
1189133301 X:38522894-38522916 ATTCTCTATCTTGACTATAGTGG - Intronic
1191998762 X:67125802-67125824 ATGTTCTTCTTGGCATATAGGGG - Intergenic
1195910082 X:109880564-109880586 ATTCTCCACCTGGCAGTCAGAGG + Intergenic