ID: 1045767155

View in Genome Browser
Species Human (GRCh38)
Location 8:105686958-105686980
Sequence CTGTGTGCGTAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 347}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045767155_1045767161 17 Left 1045767155 8:105686958-105686980 CCCTCTTCCTTCTACGCACACAG 0: 1
1: 0
2: 2
3: 21
4: 347
Right 1045767161 8:105686998-105687020 GTGTCCTGTGTAGTTAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045767155 Original CRISPR CTGTGTGCGTAGAAGGAAGA GGG (reversed) Intronic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
901948215 1:12720801-12720823 CTGTGTCTGTAGGAAGAAGACGG + Intronic
902370748 1:16005419-16005441 CTGTGTTCCTGGAAGGCAGATGG + Intronic
902400046 1:16152637-16152659 CTGGGTGGGTAGAAGGACAAAGG + Intronic
902669145 1:17960519-17960541 CTGTGTGTGCAGAAGGAATGTGG - Intergenic
903550755 1:24156208-24156230 CAGTGAGGGTAGAAGGAAGGAGG + Exonic
904894203 1:33801900-33801922 CTGTGTGCTTTGCTGGAAGAAGG + Intronic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905194803 1:36267600-36267622 CTTTGTGGGGAGAAGAAAGAGGG + Intronic
906785350 1:48610851-48610873 GTGTGTGTGTGGAAGGAGGAGGG - Intronic
910689618 1:89952792-89952814 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
910793021 1:91070579-91070601 CTGAGTTTGTAGCAGGAAGAGGG + Intergenic
910916589 1:92296243-92296265 GTGTGTACCTAGAAGGAAGATGG + Intronic
912524077 1:110267759-110267781 CTGTGAGGTTAGAAGCAAGATGG - Intronic
913069930 1:115289653-115289675 TTGTATGCAGAGAAGGAAGATGG - Intronic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
915014312 1:152719075-152719097 TTGTCTGGGCAGAAGGAAGAAGG + Intergenic
915510705 1:156385532-156385554 CTCTGAGCAGAGAAGGAAGAGGG + Intergenic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916812420 1:168317147-168317169 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
918077796 1:181183538-181183560 CTGTGTCCTAAGAAGGAGGATGG + Intergenic
918170264 1:181989631-181989653 ATGTGTGAGGAGAAAGAAGAAGG - Intergenic
918264479 1:182828533-182828555 CTGTGTTTGAAGCAGGAAGAGGG + Intronic
918294483 1:183143279-183143301 CCTTTTGCTTAGAAGGAAGAGGG - Exonic
920954626 1:210607029-210607051 CTGGGGGTGAAGAAGGAAGAGGG + Intronic
922334129 1:224605359-224605381 CTGTGGGGCTAGAAGCAAGATGG - Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922994847 1:229947703-229947725 CTATGTTCGAGGAAGGAAGAAGG + Intergenic
923015144 1:230120732-230120754 GTGTGTGCGGAGGAGGATGAGGG - Intronic
923319529 1:232816939-232816961 CTGTGTCCTTACATGGAAGAAGG + Intergenic
923525851 1:234772134-234772156 CTGTGGGGGTCGGAGGAAGAAGG - Intergenic
1063225179 10:4008847-4008869 CTGTGTTAGTTAAAGGAAGATGG - Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1064648242 10:17482094-17482116 CTGTGAGGCTAGAAGCAAGACGG + Intergenic
1065125095 10:22566460-22566482 GAGTGTGCGTAGAGGGAAGGGGG - Intronic
1065363395 10:24910850-24910872 CTGTCTCCTTAGCAGGAAGATGG - Intronic
1066061555 10:31727965-31727987 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1067786586 10:49254737-49254759 CTGGGTGGGAGGAAGGAAGAGGG + Intergenic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1069136603 10:64773982-64774004 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1069786054 10:70988645-70988667 CTGTGTGCGTCTCAGGCAGAGGG + Intergenic
1069806450 10:71128161-71128183 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1069918924 10:71804395-71804417 CTGTGTGCTTAGAAGAAAGGGGG - Intronic
1073789203 10:106922602-106922624 CTGTGTGTGTACAAGGGAGGGGG - Intronic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1075413738 10:122247747-122247769 CAGTGGGGGTAGAAGGGAGACGG + Intronic
1075445820 10:122512110-122512132 CTGTGGGGGTAGCAGGAAGAGGG + Intronic
1075744655 10:124718397-124718419 ATGTGGGGGTAGAAGGGAGAAGG - Intronic
1075744774 10:124719285-124719307 CAGAGTGCTTAGAAGGAAGTGGG - Intronic
1076063568 10:127431062-127431084 CTGTGTGCTCAGGAGGAAGCTGG + Intronic
1077172244 11:1172287-1172309 CTGAGTGTGTAGCAGGATGAAGG + Intronic
1077231981 11:1461829-1461851 ATGTGTGTGTAGAAAGAAGCAGG - Intronic
1077789960 11:5428676-5428698 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1078723726 11:13908775-13908797 CTGTGAGATTAGAAGGCAGAAGG - Intergenic
1080905655 11:36542394-36542416 CTTTGTGTGTAGAAGGAAAGAGG - Intronic
1081107522 11:39088969-39088991 GTGTGTGTGTATAAGAAAGAGGG - Intergenic
1082256916 11:50041990-50042012 CTGTGTGTAAAGAAGGAAAATGG + Intergenic
1082820038 11:57538505-57538527 CTGTGCACCTAGAAGAAAGAGGG + Intergenic
1085489926 11:76906036-76906058 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1087235850 11:95717909-95717931 CTGGGTGAATAGAAGGTAGATGG - Intergenic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1087966672 11:104423242-104423264 CTGTGTTTGTAAAAGGAACAGGG + Intergenic
1089802319 11:121043685-121043707 CTGGGAGTGGAGAAGGAAGATGG - Intronic
1089829100 11:121309409-121309431 CTGTGTGCCTGGGAGGAAGGGGG + Intergenic
1089869293 11:121657732-121657754 CTGTGTGCGTAGAATGGCTAAGG + Intergenic
1089956647 11:122577315-122577337 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1089973822 11:122715644-122715666 ATGTGTGCTTTGAAGGAAGTAGG - Intronic
1091099233 11:132854876-132854898 CTGTGAGGCTAGAAGAAAGATGG - Intronic
1091593112 12:1857098-1857120 ATGTGTAGGAAGAAGGAAGAAGG + Intronic
1092275552 12:7058371-7058393 CTGTGAGGGTAGAGGCAAGATGG - Intronic
1092938145 12:13383166-13383188 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1098289606 12:68945335-68945357 CTGTGAGACTAGAAGCAAGATGG + Intronic
1098291874 12:68964276-68964298 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1098352795 12:69581747-69581769 CTGTTTGGGTAGTAGGGAGAAGG - Intergenic
1100284255 12:93149817-93149839 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1100773427 12:97948962-97948984 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101556953 12:105819013-105819035 GGGTGTGTGTGGAAGGAAGATGG + Intergenic
1101658730 12:106747544-106747566 CTGTGTGTGACGGAGGAAGAAGG - Exonic
1101885792 12:108660559-108660581 CTGTTTGCCTATAGGGAAGAAGG - Intronic
1102290141 12:111692674-111692696 CTGTGTGGGAAGAAGGCACAGGG - Intronic
1103791720 12:123476884-123476906 CTGTGTGTGGGGAACGAAGAAGG + Intronic
1104694964 12:130856251-130856273 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106612967 13:31301031-31301053 CTGTGAGACTAGAAGCAAGATGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107088797 13:36453676-36453698 CTGTGTGGTTAAAAGGAAGCAGG - Intergenic
1108315830 13:49236257-49236279 CTGTGAACCTAGAAGCAAGACGG + Intergenic
1109909871 13:68895347-68895369 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1113386040 13:109849146-109849168 CTGCATGTGTAGAAGGATGATGG + Intergenic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114899793 14:27043415-27043437 CTGTGGGTGAAGAAGGAAAAGGG + Intergenic
1115029547 14:28778234-28778256 CTGCGTGCGTAAAAAGACGAAGG - Intronic
1117498510 14:56329447-56329469 AGGTGTGCGTAAAAGGAAGAAGG + Intergenic
1119383774 14:74244662-74244684 CTCTGTGCTTGGGAGGAAGAGGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119655093 14:76411602-76411624 CTGTGTGTGTTGCAGGAAGGAGG + Intronic
1120150075 14:81022946-81022968 CTGTGTCCTTAGATGGCAGAAGG - Intronic
1122482746 14:102058023-102058045 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1126416973 15:48427883-48427905 CTGGGTGAGAAGAAGCAAGAGGG + Intronic
1126460807 15:48913314-48913336 CTGTGTACCTAGAAGGATTATGG + Intronic
1127042071 15:54988075-54988097 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1128479345 15:68023839-68023861 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129747368 15:78033253-78033275 GTGTGTGCGTATAAGTAAGGTGG - Intronic
1130033691 15:80339414-80339436 CTGTCTACTTGGAAGGAAGAAGG + Intergenic
1132991339 16:2796696-2796718 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1133467202 16:6039090-6039112 CTGTGTGCATAGCGGGGAGAAGG + Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1133921417 16:10156631-10156653 CTGAGTGCATAGGAGGCAGAAGG + Intronic
1134392607 16:13833357-13833379 CTTGGTGGTTAGAAGGAAGATGG - Intergenic
1134528804 16:14965971-14965993 CTGTGTGCCCAGAAGGCAAATGG - Intergenic
1135407413 16:22207844-22207866 CTGTGTGTGTAAAGGGGAGAGGG + Intronic
1135509171 16:23067658-23067680 ATTAGTGCGTAGAAGGAGGAAGG - Exonic
1135903853 16:26492211-26492233 CTGGGTGCTTAGAATGAAGGAGG - Intergenic
1136220733 16:28826423-28826445 CTGTGTGCATAGAGGACAGAGGG + Intronic
1136554860 16:31001677-31001699 GTGTGTGCATAGCAGGGAGAGGG - Intronic
1136934072 16:34442796-34442818 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1136970500 16:34969018-34969040 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
1137580097 16:49628316-49628338 ATGCGTGGGTAGATGGAAGATGG - Intronic
1137936531 16:52640229-52640251 GTCTGTGAGAAGAAGGAAGAGGG + Intergenic
1138784354 16:59828830-59828852 CTGTGTGCTTAGGATGATGAAGG + Intergenic
1139867560 16:70075006-70075028 CTGTGTGCCCAGAAGGCAAATGG + Intergenic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146534481 17:33638379-33638401 CTGTGAGGATAGAAGCAAGATGG + Intronic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1146974096 17:37096317-37096339 CTGGGTGCCTGGTAGGAAGAAGG - Intronic
1146986030 17:37219076-37219098 CTGTGTGATTAGAAGGTTGAGGG + Intronic
1147399963 17:40174780-40174802 CTGGGTGGGCAGAAAGAAGAGGG + Intergenic
1148642381 17:49197769-49197791 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1148729699 17:49825915-49825937 CTGTGTGCCAACATGGAAGAAGG - Intronic
1149726848 17:58903696-58903718 TTGAGTTCTTAGAAGGAAGAGGG + Intronic
1151000613 17:70370955-70370977 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1152388277 17:79988106-79988128 GTGTGTGTTTAGAAGGGAGAGGG + Intronic
1153073258 18:1131526-1131548 CTGTGTGTGTAGGAGGATGGAGG + Intergenic
1153271989 18:3331517-3331539 CTCTGTGAGTATAAGGAATAAGG - Intergenic
1153282207 18:3425229-3425251 CTGTGAGGATAGAAGCAAGATGG - Intronic
1153450251 18:5219189-5219211 CTGTGTGCACAGAAGTCAGAAGG - Intergenic
1157409490 18:47451905-47451927 CTGTCTGCACAGAAGGTAGAAGG + Intergenic
1158525223 18:58207267-58207289 CTGTGTGGGGATCAGGAAGAGGG + Intronic
1159752887 18:72324728-72324750 CTGTGTGCAGACCAGGAAGAGGG + Intergenic
1160179715 18:76623756-76623778 CTGTGTGCTTGGAGCGAAGAGGG + Intergenic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1161520862 19:4722972-4722994 CTGTGTGGGAAGAAGGTAGGCGG + Intronic
1161679798 19:5674068-5674090 GTGAGTGCGTAGATGGATGATGG - Intergenic
1163431191 19:17268779-17268801 CTGTGTGGCTAGATGGAACACGG - Exonic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1163704464 19:18804250-18804272 CTGTGTGCGTTGCAGGGAGATGG + Intergenic
1164817948 19:31220808-31220830 CTGTGTGCTCAGAAAGATGAAGG + Intergenic
1164935524 19:32207538-32207560 ATTTGTGGGTAGAAGGAAGGCGG + Intergenic
1165093594 19:33398871-33398893 CCTTGTGGGTAAAAGGAAGAGGG - Intronic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1166037107 19:40176641-40176663 CTGTGAGCTTAGAAGCAAGATGG - Intergenic
925516987 2:4693501-4693523 CTGCGTGGGGAGAGGGAAGACGG + Intergenic
926052440 2:9753717-9753739 CTGTGTGCTAAGAGGGAAGCTGG + Intergenic
926871470 2:17422632-17422654 CTGTGAGGTTAGAAGTAAGATGG + Intergenic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
928671314 2:33606359-33606381 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
928931194 2:36626103-36626125 CTGTGAGACTAGAAGCAAGATGG + Intronic
929643499 2:43604903-43604925 TGGTGTGTGTGGAAGGAAGAGGG - Intergenic
930506938 2:52294307-52294329 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
931432612 2:62220269-62220291 CTGTGAGGGTAGACGCAAGATGG + Intronic
931874213 2:66494782-66494804 CTTTGTGGGTAGAAGAAGGAAGG + Intronic
932461109 2:71882631-71882653 ATGTGAGCCTAAAAGGAAGATGG + Intergenic
932641226 2:73449237-73449259 CTGTGTGAGTAGAAACTAGATGG - Exonic
932641285 2:73449804-73449826 CTTTGTGAGTAGAAAGTAGACGG - Exonic
932641358 2:73450515-73450537 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
932641388 2:73450800-73450822 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
932987412 2:76742954-76742976 CTGTCTGCAAACAAGGAAGAAGG + Intergenic
933587201 2:84192223-84192245 CTGAGTGCCTAGTAGGAAAAGGG + Intergenic
935156266 2:100486214-100486236 CTGTGGGGTTAGAAGCAAGATGG + Intergenic
935161315 2:100531844-100531866 CTGCGTGCTGAGAAGGATGAAGG + Intergenic
935466153 2:103400409-103400431 CTATATGCTTAAAAGGAAGATGG + Intergenic
935494667 2:103765419-103765441 GTGTGTGGGCAGAAGGATGAGGG - Intergenic
937010578 2:118559383-118559405 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
937759878 2:125588477-125588499 CTATGAGGGTAGAAGCAAGATGG + Intergenic
938242938 2:129757166-129757188 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
938372476 2:130780484-130780506 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
938701944 2:133887422-133887444 CTATGTGCTTAGTAGGAAGAAGG + Intergenic
939548797 2:143588020-143588042 CTGTTTGGAAAGAAGGAAGAGGG - Intronic
939895922 2:147791328-147791350 TAGTGTGCTTAGTAGGAAGAAGG - Intergenic
940910608 2:159206408-159206430 CTCTCTGCGAAGAAGGCAGAGGG + Intronic
941960116 2:171245222-171245244 CTGTGAGACTAGAAGCAAGATGG - Intergenic
942766206 2:179460277-179460299 CTGTGAGAATAGAAGCAAGATGG - Intronic
944453852 2:199873495-199873517 TTGTGAGCTTAGAAGCAAGATGG - Intergenic
945039281 2:205730611-205730633 CGGTGTGCAGGGAAGGAAGAGGG + Intronic
945523442 2:210858709-210858731 CTATGTGTGAAGAAGGATGACGG - Intergenic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
946687163 2:222281911-222281933 GTTTGTGCTTAGATGGAAGATGG - Intronic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
1169477153 20:5941932-5941954 ATGGGTGCGTTGATGGAAGAAGG - Exonic
1171398216 20:24854056-24854078 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1173148565 20:40546422-40546444 CTCTGTGAGTACAAGGATGAGGG + Intergenic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1174263485 20:49314506-49314528 CTGGGTGGGGAGAAGGAAGGAGG - Intergenic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1177789885 21:25711390-25711412 CTATGGGCGTAGAGAGAAGATGG + Intronic
1182676562 22:32043657-32043679 CTGTGAGCAGAGAAGGAAGGTGG + Intronic
1183287350 22:36975667-36975689 CTGTGAGGTTAGAAGCAAGACGG - Intergenic
1184591619 22:45487631-45487653 TTCTGTGCGTATAAGGAAGTTGG + Intergenic
1185056358 22:48580657-48580679 CGGTGTGTGTGGAAGGAGGAGGG + Intronic
949588183 3:5464238-5464260 CTGGGGGAGTAGAAGGAAGTGGG + Intergenic
950545700 3:13636788-13636810 ATGTGTGTGTATGAGGAAGAGGG - Intronic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
954280353 3:49572868-49572890 CTGTGTGTGCAGAAGAAAGGAGG + Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
955393337 3:58536901-58536923 CTGTGTTAGTAGCAGGGAGATGG - Intronic
956135739 3:66096760-66096782 CTGTGAGGCTAGAAGCAAGAAGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
960707946 3:120499332-120499354 GTGTGTGTGTAGTAGAAAGAGGG - Intergenic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961264742 3:125632798-125632820 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
961265049 3:125634921-125634943 CTTGGTGGGGAGAAGGAAGATGG + Intergenic
962202817 3:133414844-133414866 AGGTGTGAGTAGATGGAAGAGGG - Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962920942 3:139949940-139949962 ATGTGTGTGTAGAGGCAAGAAGG + Intronic
963059296 3:141211958-141211980 CTTGGTGGGTAGAAGCAAGATGG - Intergenic
963512501 3:146266009-146266031 CTGTGTGAATATAAGGAAAATGG + Intergenic
965200603 3:165653333-165653355 CTGTGAGGGTAGGAGCAAGATGG - Intergenic
965870723 3:173261238-173261260 CTGTGAGGCTAGAAGTAAGATGG + Intergenic
966333846 3:178846205-178846227 CATTGTCCGTATAAGGAAGAAGG + Intergenic
967431373 3:189389887-189389909 CTGTCTACCTAGAAGGAAGTAGG + Intergenic
971659161 4:29389810-29389832 CTGTGTAGCTAGAAGCAAGATGG - Intergenic
971975565 4:33681662-33681684 CTGTGAGGCTAGAAGAAAGATGG + Intergenic
973074039 4:45900587-45900609 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
974416078 4:61607940-61607962 CTGTGAGGCTAGAAGCAAGATGG + Intronic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975851054 4:78572965-78572987 CTGTGAGGCTAGAAGCAAGATGG + Intronic
976188836 4:82469662-82469684 TTGTGAGGTTAGAAGGAAGATGG + Intergenic
976600938 4:86936467-86936489 CGGTGTGTGTAGAAGGTAGGTGG + Intronic
979350902 4:119643452-119643474 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
979669102 4:123343574-123343596 CTGTGTGCTTGGAAGGAGGTGGG - Intergenic
980087195 4:128403623-128403645 CTGTGTACCTAGAAGGATTATGG + Intergenic
980564277 4:134518336-134518358 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
982106067 4:152013123-152013145 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
983626328 4:169805291-169805313 CTGTGAGGCTAGAAGCAAGAAGG - Intergenic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
985100482 4:186453257-186453279 CTGTGGGGCTAGAAGCAAGATGG + Intronic
986241487 5:5964149-5964171 CTGTGAGGTTAGAAGCAAGATGG - Intergenic
987733411 5:21806776-21806798 CTGTGAGGCTAGAAGCAAGATGG - Intronic
988217954 5:28301390-28301412 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
988441769 5:31241832-31241854 CCATGTGCCTAGAAGGAAAAAGG + Intronic
988473533 5:31563355-31563377 CTGTGAGGCTAGAAGCAAGACGG - Intergenic
988854492 5:35214712-35214734 CTGTGAGGTTAGAAGCAAGATGG - Intronic
990191318 5:53263301-53263323 ATGTGTGAGTAGAAAGCAGAGGG - Intergenic
990260130 5:54013332-54013354 CTGTGAGGTTAGAAGCAAGATGG - Intronic
990325545 5:54671880-54671902 CTGTGAGACTAGAAGCAAGATGG - Intergenic
990703629 5:58502306-58502328 CTGTGTATGTAGCAGCAAGAAGG + Intergenic
990972782 5:61527635-61527657 GTGTATGTGTTGAAGGAAGAAGG - Intronic
991599902 5:68341872-68341894 CTGTGTCCTTTGAAGGATGAGGG + Intergenic
991959005 5:72022879-72022901 GTGTGTGTGTTGGAGGAAGAGGG - Intergenic
992959025 5:81940269-81940291 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
995075451 5:107978196-107978218 GTGTGTGGCTAGAAGCAAGATGG - Intronic
996492301 5:124111943-124111965 CTTTGTTCCCAGAAGGAAGAAGG - Intergenic
996995131 5:129686622-129686644 CTGTGTCCTTAGGAGAAAGAAGG + Intronic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
999333262 5:150692865-150692887 CTCTGGGCTAAGAAGGAAGATGG + Intronic
1000371212 5:160538379-160538401 ATGAGTACGTAGAAGGAAAATGG - Intergenic
1000938482 5:167331591-167331613 TTGGGCGCGAAGAAGGAAGATGG + Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004232691 6:13847303-13847325 CTGTGAGATTAGAAGCAAGATGG - Intergenic
1004279922 6:14271929-14271951 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1005030240 6:21501481-21501503 CTGTATGCAAAGAAGGAAGATGG - Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1008447773 6:51613038-51613060 CTGTTTGTGAACAAGGAAGAGGG - Intergenic
1008946363 6:57101374-57101396 CTGTGTCCCATGAAGGAAGAAGG - Intronic
1011075074 6:83430711-83430733 TGGTGTGGGCAGAAGGAAGAAGG - Intronic
1011555588 6:88568883-88568905 CTGTGTCCTTACAAGGAGGAAGG - Intergenic
1012096640 6:94970862-94970884 GTGTATGTGGAGAAGGAAGAGGG + Intergenic
1012248336 6:96952452-96952474 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1012603331 6:101126181-101126203 CTCTGTGAATAGAAGAAAGAAGG - Intergenic
1013067505 6:106698092-106698114 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1014694859 6:124607645-124607667 GTGTGTGTGTATAACGAAGATGG - Intronic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015419904 6:132995515-132995537 TTGTGTGCATTTAAGGAAGACGG + Intergenic
1016678468 6:146799716-146799738 ATGTGTGTGTAGGAGGAAGGGGG + Intronic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017039610 6:150297077-150297099 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1020450980 7:8320154-8320176 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1021420963 7:20444251-20444273 CTGTGAGACTAGAAGCAAGAAGG - Intergenic
1021822982 7:24516457-24516479 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1022022995 7:26419107-26419129 CTCTGTGCGCAGAAAGCAGACGG - Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024002672 7:45201291-45201313 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1026602468 7:71787920-71787942 AGGTGTGGGAAGAAGGAAGAGGG + Intronic
1027161360 7:75804843-75804865 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG + Intronic
1032932078 7:136684492-136684514 CTGTGTCCTTACATGGAAGAAGG + Intergenic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033077101 7:138259851-138259873 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1033345940 7:140525859-140525881 CTGCATGCCAAGAAGGAAGAAGG - Intronic
1033889226 7:145988304-145988326 TTGTGTGTGGAGAAGAAAGAGGG - Intergenic
1034694685 7:153043217-153043239 TTGTGTGTGTTGAAGGAAGGAGG - Intergenic
1035308777 7:157952019-157952041 CTGTGAGCTTGGGAGGAAGATGG - Intronic
1035815920 8:2540300-2540322 GTGTGTGCGGAGAAGGGAGGCGG + Intergenic
1037946312 8:22991698-22991720 CTGTGTACCAAGAAGGCAGAGGG + Intronic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1039303153 8:36231879-36231901 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1039727306 8:40232736-40232758 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1040433820 8:47370219-47370241 CTGTCTCCTTAGAAGGCAGAAGG + Intronic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1043379969 8:79691997-79692019 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1043380980 8:79701896-79701918 CTGTGTCCTTACAGGGAAGAAGG + Intergenic
1044233103 8:89801464-89801486 CTGTGAGACTAGAAGCAAGAGGG - Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044573812 8:93747482-93747504 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1045734196 8:105276142-105276164 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1046717568 8:117584316-117584338 CTGGTTCCCTAGAAGGAAGAAGG + Intergenic
1047312420 8:123703879-123703901 CAGTGTGCGAATAAGAAAGACGG + Intronic
1047983244 8:130205174-130205196 CTATGTGAGAGGAAGGAAGAAGG - Intronic
1048648411 8:136448209-136448231 CTGTCTGCAAATAAGGAAGAGGG - Intergenic
1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG + Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1050460704 9:5875256-5875278 CAGTGTACGTAGTTGGAAGAGGG + Intergenic
1050983078 9:12045873-12045895 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1053009216 9:34623863-34623885 CTGGGTGCGTAGAGTGAAGGCGG + Exonic
1054337870 9:63823833-63823855 CTGTGTGTGTAGTAGGTACACGG - Intergenic
1054907426 9:70423075-70423097 ATGTCTGCATACAAGGAAGATGG - Intergenic
1055520899 9:77080161-77080183 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1056956510 9:91086008-91086030 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1057985455 9:99708887-99708909 CTGTGTGCATACTAGCAAGAAGG - Intergenic
1059356107 9:113700705-113700727 CTGTGTGCCAAGAAGAAAGATGG + Intergenic
1060768114 9:126310012-126310034 CTGTGTGCTTACATGGCAGAAGG - Intergenic
1202784659 9_KI270718v1_random:37432-37454 CTGTGTGTGTAGTAGGTACATGG + Intergenic
1185559376 X:1047524-1047546 TTATGTGAGCAGAAGGAAGATGG - Intergenic
1185913034 X:4003352-4003374 CTGTGTTCTTAAATGGAAGAAGG - Intergenic
1186047900 X:5556227-5556249 CTGTGTGGCTAGAAGCAAGCTGG - Intergenic
1187007614 X:15247870-15247892 CAGTGAGAGTAGGAGGAAGAAGG + Intronic
1187112715 X:16318061-16318083 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1187136339 X:16551157-16551179 CTGTGAGGTTAGAAGCAAGATGG + Intergenic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1188396775 X:29694661-29694683 CTGTGTTCTTATAAGGTAGAAGG + Intronic
1189142895 X:38625336-38625358 CTGTGTGCCTAGGAAGAAGATGG - Intronic
1189365580 X:40385419-40385441 CTGTTTCCGTAGAAAGAATATGG - Intergenic
1189833489 X:44998290-44998312 CTCTGTGAATAGAAGGAACATGG + Intronic
1193910541 X:87300935-87300957 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1195205462 X:102595426-102595448 CTGGATGGGTAGAAGGGAGAGGG - Intergenic
1197347750 X:125345272-125345294 CTGTGAGGCTAGAAGCAAGAAGG + Intergenic
1197652627 X:129082368-129082390 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1198649262 X:138843227-138843249 CTCTGTAGGTAGATGGAAGAAGG - Intronic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1201642031 Y:16190397-16190419 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1201660784 Y:16394924-16394946 CTGTGAGGCTAGAAGCAAGATGG + Intergenic