ID: 1045767155

View in Genome Browser
Species Human (GRCh38)
Location 8:105686958-105686980
Sequence CTGTGTGCGTAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045767155_1045767161 17 Left 1045767155 8:105686958-105686980 CCCTCTTCCTTCTACGCACACAG No data
Right 1045767161 8:105686998-105687020 GTGTCCTGTGTAGTTAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045767155 Original CRISPR CTGTGTGCGTAGAAGGAAGA GGG (reversed) Intronic
No off target data available for this crispr