ID: 1045769121

View in Genome Browser
Species Human (GRCh38)
Location 8:105713664-105713686
Sequence CTGGTTAAGCATATGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045769121 Original CRISPR CTGGTTAAGCATATGCAGCC TGG (reversed) Intronic
900326118 1:2109528-2109550 ACGGTTGAGCAGATGCAGCCAGG + Intronic
909636708 1:77824866-77824888 ATGGTTAAGGAAATGCAGCATGG - Intronic
909836414 1:80260634-80260656 CTGGTTCAGCAGCTGGAGCCAGG + Intergenic
910262231 1:85303808-85303830 CTGGTAAAGCAGCTTCAGCCAGG - Intergenic
910969028 1:92835815-92835837 ATTGTTAAGCATGTGCAGCAAGG + Intronic
912452287 1:109774434-109774456 CTGGATGAGCAAATGCAGCCTGG - Intronic
922358897 1:224802848-224802870 CTGCTTTAGAATATGCTGCCAGG - Intergenic
923143357 1:231180417-231180439 CTCGGTAAACATATGAAGCCAGG + Intronic
1064325947 10:14351243-14351265 CTGCTAAAGCATATGCAACTTGG - Intronic
1068914814 10:62418693-62418715 CTGTTTAAGCATATTCATCTTGG + Intronic
1075066613 10:119293121-119293143 TTGTTTAAGGTTATGCAGCCAGG + Intronic
1075485173 10:122815765-122815787 CTGATTAACCACATGGAGCCCGG + Intergenic
1077649103 11:3953474-3953496 CTGGATCAGCCTATGCAACCGGG - Intronic
1077763992 11:5137158-5137180 CTGGATAAGAAAAGGCAGCCTGG + Intergenic
1082680969 11:56169636-56169658 CTTTTTAAGCATATCCATCCTGG - Intergenic
1087337606 11:96864018-96864040 ATGGCTAACTATATGCAGCCAGG - Intergenic
1088533977 11:110839817-110839839 CTAGTTAAGCATATGAACCCTGG + Intergenic
1090554987 11:127864499-127864521 CTGGTTAGAAATATGTAGCCAGG - Intergenic
1090665866 11:128914530-128914552 GTTGTCAAGCACATGCAGCCAGG + Intronic
1091259552 11:134223844-134223866 CTCGGTGAGCAGATGCAGCCGGG - Exonic
1091437309 12:482698-482720 TTTCTTAAGCATATGCAGCCAGG + Intronic
1091682124 12:2534601-2534623 CTGGATAAGCATTTGCTGCAGGG - Intronic
1091823515 12:3492885-3492907 ATGGTTACCCATATGCAGCGGGG + Intronic
1101698280 12:107147488-107147510 CTGGCTAAGCACATGCAGGAAGG + Intergenic
1105292735 13:19062868-19062890 CTGGAAAGGCATCTGCAGCCTGG + Intergenic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1105458183 13:20560222-20560244 CTGGTGATGCAGTTGCAGCCAGG - Intergenic
1106207539 13:27613815-27613837 GTAGTTAATCATTTGCAGCCGGG - Intronic
1106543179 13:30708022-30708044 TTGGTTAAGCTTCTGCAGTCAGG - Intergenic
1107182186 13:37473694-37473716 CTGGAGAAGTGTATGCAGCCTGG + Intergenic
1108044053 13:46366204-46366226 CTGGTTGGTCAGATGCAGCCAGG - Intronic
1111002616 13:82205375-82205397 CTGCTTGAGCATGTGCAGCCTGG - Intergenic
1111882254 13:93972127-93972149 TAGGTTAAGCAAATGAAGCCTGG + Intronic
1117541010 14:56746489-56746511 CTCGTTAAGGCAATGCAGCCTGG + Intergenic
1121096985 14:91224225-91224247 TTGGTTAAGGAAATGCAGGCTGG + Intronic
1126059113 15:44761758-44761780 CTCATTAGGGATATGCAGCCGGG - Intronic
1128726899 15:69994692-69994714 CTGGTAAAGCAAAAGAAGCCTGG + Intergenic
1129773677 15:78219105-78219127 GTGGTTAAGAAGATGCAGCTGGG - Intronic
1134842738 16:17414702-17414724 CTGGTTAAGGCTATGGAGCCAGG + Intronic
1140633043 16:76877556-76877578 CTGGTTAACCATATGAGACCAGG - Intergenic
1141533343 16:84661734-84661756 CTGGCACAGCATGTGCAGCCTGG + Exonic
1141607831 16:85165286-85165308 GTGGTTAAGCATTTGGAGGCTGG + Intergenic
1142970762 17:3610003-3610025 CCAGCTAAGCATCTGCAGCCAGG + Exonic
1148887023 17:50781293-50781315 CTCGTGACGCATACGCAGCCTGG - Intergenic
1152112869 17:78366698-78366720 CTGGTCAAGCTCCTGCAGCCCGG + Intergenic
1153822390 18:8843394-8843416 CTGGGAAAGCAAATGGAGCCAGG + Intergenic
1157798011 18:50593457-50593479 CTGCTGAAGCATATACAGCTAGG - Intronic
1158302278 18:56065416-56065438 CTGGGTAAGCATATGGACTCTGG + Intergenic
1162161970 19:8724909-8724931 GTGGTTAAGAAAATGCACCCAGG - Intergenic
1167007070 19:46783010-46783032 CTAGTTAAGGATGGGCAGCCAGG + Intronic
1167230494 19:48279888-48279910 CAGGTAAAGCACATGGAGCCAGG + Intronic
1167280532 19:48565291-48565313 GTAGTTAATAATATGCAGCCTGG - Intronic
1168445841 19:56412273-56412295 ATGGTTAGGCATATGCATCTTGG - Intronic
926317366 2:11720874-11720896 CAGGTTAGGCATATGAAGCAAGG + Intronic
927388480 2:22564485-22564507 CAGATTAAGTAAATGCAGCCAGG - Intergenic
928021662 2:27709972-27709994 CAGGTTAAGCATTTGCTGGCAGG + Intronic
928170210 2:28998574-28998596 CTTGTCCAGCATCTGCAGCCTGG + Intronic
928939327 2:36711874-36711896 CTGGTGAGGCAAATGAAGCCTGG - Intronic
932804415 2:74770675-74770697 CTGATTCAGCAGGTGCAGCCAGG - Intergenic
939377778 2:141392086-141392108 CTGGTTAAGCTGATGAAGCAAGG + Intronic
942620689 2:177842544-177842566 CTGTTTAAGAATATGGAGCAGGG + Intronic
943000096 2:182316097-182316119 CTTGCTAAGCAGATGCATCCAGG + Intronic
943208983 2:184938465-184938487 CTGGTAAAGCTAATGGAGCCAGG - Exonic
947670714 2:231933839-231933861 CTGGCTCAGCACAGGCAGCCAGG + Intergenic
1170923160 20:20698095-20698117 CTGGTTAAACATATACATACAGG + Intronic
1171383712 20:24752897-24752919 CTGGTCAAGCCTCTGCAGGCAGG + Intergenic
1172742135 20:37177283-37177305 CAGACTTAGCATATGCAGCCAGG - Intronic
1174534960 20:51244250-51244272 CAGGATCAGCATTTGCAGCCAGG + Intergenic
1183850961 22:40587597-40587619 CTGGTAAGGCAGAGGCAGCCAGG + Intronic
1184102330 22:42347407-42347429 CTGCTCCAGCAGATGCAGCCTGG + Intergenic
955563718 3:60222091-60222113 CTAGTTAAGCATTTCCATCCAGG + Intronic
959807753 3:110577670-110577692 CTGGTCAAGCATATCCTGCTTGG + Intergenic
961714497 3:128849332-128849354 CTGGTCCAGCATATGCTGACAGG - Intergenic
961981832 3:131087535-131087557 GTGGTTAAGAATTTGCGGCCGGG - Intronic
980777960 4:137461279-137461301 CTGTTTAAGAATTTTCAGCCGGG - Intergenic
983031409 4:162806722-162806744 CTGGATATCCATATGCAGACAGG - Intergenic
985258813 4:188096101-188096123 CTGGTAAAGAATCTGCAGCCAGG + Intronic
986834636 5:11621837-11621859 CTCATTAAGCATATGTAGGCGGG + Intronic
996024689 5:118631803-118631825 TTGGTTTAGCATATGCAGCTTGG - Intergenic
996157266 5:120116925-120116947 CTTTTTAAGCATATGCAGATAGG + Intergenic
999851137 5:155540890-155540912 ATGGTTAGGAATATGCAGCTTGG - Intergenic
1002650674 5:180690823-180690845 CTCATAAAGCACATGCAGCCTGG - Intergenic
1003395512 6:5749298-5749320 CTGGCTAAGCATTTTCAGCAGGG + Intronic
1003827972 6:9973727-9973749 TTGGTTTTGCATATTCAGCCTGG + Intronic
1013229225 6:108146431-108146453 AATGTTAACCATATGCAGCCAGG - Intronic
1017862378 6:158410970-158410992 CTGGTTTATCATAGGCAGGCAGG + Intronic
1018171463 6:161146530-161146552 CTGGTAGAGCTTGTGCAGCCAGG + Exonic
1024599070 7:50963579-50963601 CTGGTTAGGCGTCTGCACCCAGG - Intergenic
1025897346 7:65715800-65715822 TTGGTTTAGCTTGTGCAGCCAGG + Intergenic
1028502830 7:91538062-91538084 CTGGCTCAGCCTGTGCAGCCCGG + Intergenic
1029363829 7:100104938-100104960 CTGGTGAGGCATCTGCAGGCAGG + Exonic
1031896297 7:127352416-127352438 CTGGCCATGCATCTGCAGCCTGG + Intronic
1033538948 7:142338462-142338484 CTGATTAAGCAAAGGGAGCCAGG + Intergenic
1038431553 8:27504396-27504418 CTGGTTAGGCAGATAAAGCCAGG + Intronic
1042902418 8:73742656-73742678 CTGGTCAGGCATATGAAGACAGG + Intronic
1044546033 8:93460449-93460471 GTGGTTAAGCACATACACCCTGG - Intergenic
1045769121 8:105713664-105713686 CTGGTTAAGCATATGCAGCCTGG - Intronic
1045798749 8:106077611-106077633 CTTGTGAAGCATGTGCGGCCTGG + Intergenic
1046543778 8:115620850-115620872 CTGGGTGTCCATATGCAGCCTGG + Intronic
1048911920 8:139143325-139143347 CTGGTTAGTCATCTGCTGCCAGG - Intergenic
1053290064 9:36873902-36873924 CTGGTTAAGCATGTGAAACAGGG - Intronic
1053316403 9:37055489-37055511 ATGGTTAAGCATATGGACTCTGG + Intergenic
1059885964 9:118745032-118745054 CTGTGCAATCATATGCAGCCTGG + Intergenic
1188308622 X:28589025-28589047 ATGTTTAAGCATATTCTGCCTGG + Intronic