ID: 1045769708

View in Genome Browser
Species Human (GRCh38)
Location 8:105721706-105721728
Sequence ATGGATAGAAGGCCTGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045769708 Original CRISPR ATGGATAGAAGGCCTGATGA AGG (reversed) Intronic
900478152 1:2885762-2885784 ATGGGGAGAAGGCCGCATGAAGG - Intergenic
900535806 1:3176693-3176715 ATGGATAGATGGACAGATGGTGG - Intronic
900896766 1:5488115-5488137 ATGGGTAGAAGGACAGATGGTGG - Intergenic
902309224 1:15568108-15568130 ATGGATGGAACGCCTGCTGGAGG + Exonic
904465134 1:30703124-30703146 ATGGATAGATGGATAGATGATGG + Intergenic
906562023 1:46765314-46765336 ATGGAGAGAAGGAATGAAGAGGG - Intronic
907703118 1:56808851-56808873 ATGGAGAGAAAGCCGAATGATGG + Intronic
908829653 1:68166406-68166428 ATGGATGTGAGGCCTGAAGAAGG - Intronic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
913341614 1:117763533-117763555 ATGGATATATTGCCTAATGATGG + Intergenic
915986788 1:160474140-160474162 ATGGATTGTAGGCCAGAGGATGG + Intergenic
917115246 1:171596570-171596592 ATGGTGAGAAGGCCAGATCAGGG - Intergenic
918634260 1:186755979-186756001 CTGTATAGAAGCCCTGATGCTGG + Intergenic
921840813 1:219826451-219826473 AAAGAAAGAAAGCCTGATGAGGG - Intronic
923301440 1:232644323-232644345 ATGGATAGATGGATGGATGAAGG - Intergenic
923822388 1:237459555-237459577 ATGGATACAATACCTGTTGAAGG - Intronic
1062937861 10:1401283-1401305 ATGGGAAGGAGGCGTGATGATGG + Intronic
1063510158 10:6636909-6636931 ATGGATAGATGGACAGATGATGG - Intergenic
1063957968 10:11283544-11283566 ATGGATAGATGGGTGGATGATGG + Intronic
1063998448 10:11642743-11642765 ATGAATAGAAGGTGAGATGAAGG - Intergenic
1065775526 10:29116051-29116073 ATTGATAGAATGCCTGAGGCTGG - Intergenic
1066275686 10:33866152-33866174 ATGGAGAGAAGGCCATGTGAAGG - Intergenic
1068362635 10:55998611-55998633 AGACATAGAAGACCTGATGAAGG + Intergenic
1068749344 10:60573624-60573646 ATGGATGGAAGGCATGGTGAGGG - Intronic
1070772399 10:79090047-79090069 AGGGAAAGAAGGCAGGATGAGGG - Intronic
1073467381 10:103702057-103702079 ATGGATAGATGGATGGATGATGG - Intronic
1077319026 11:1932705-1932727 ATGGATAGAAGGATAGATGGAGG - Intronic
1080411280 11:32027457-32027479 ATGGGAAGAAGCACTGATGATGG + Intronic
1080849334 11:36054767-36054789 ATGGATAGATGGATGGATGATGG + Intronic
1080849365 11:36054928-36054950 ATGGATGGATGGATTGATGATGG + Intronic
1081629966 11:44682367-44682389 ATGGATAGATGGATAGATGATGG - Intergenic
1083865974 11:65453189-65453211 CTGGATACAAGGCCGGAAGAAGG + Intergenic
1084177650 11:67431762-67431784 TTGGATAGAAGTCCAGAGGATGG + Intronic
1084448065 11:69215619-69215641 ATGGATGGAAAGGCTGGTGATGG - Intergenic
1084716031 11:70874037-70874059 ATGGATAGATGGCTAGATGGAGG - Intronic
1085012614 11:73151870-73151892 TTGGCAAGAAGGCCTCATGAGGG - Intergenic
1085345760 11:75767428-75767450 ATGGAGGGAAGGCCTGATCTAGG - Intronic
1086506886 11:87514375-87514397 ATGGGCAGAAGCACTGATGAGGG - Intergenic
1088842186 11:113636345-113636367 ATGGACTGAAGGACTGATGATGG + Intergenic
1089700884 11:120243089-120243111 TGGGTTGGAAGGCCTGATGATGG + Intronic
1091952892 12:4609599-4609621 ATGGAGGGAATGACTGATGAGGG + Intronic
1092255803 12:6926339-6926361 CTAGATGGAAGGCCTGAGGATGG + Intronic
1093565253 12:20595091-20595113 ATGAATAGAAGGCCAAAGGAGGG + Intronic
1096116598 12:49059088-49059110 AGTGAAAGAAGGCCTGGTGAAGG + Intronic
1096259800 12:50083352-50083374 AGGGAAGGAAGGCCTGAAGAGGG - Exonic
1097604437 12:61734855-61734877 AGGGAAAGAAGGGGTGATGAAGG - Intronic
1097808190 12:63988510-63988532 AGGGAAAGAAGGCCTGATTTAGG - Intronic
1098364065 12:69683942-69683964 ATGGCTTGAAGTCCTGATGAGGG - Intronic
1099160593 12:79236721-79236743 ATGGATAAACAGCTTGATGATGG + Intronic
1100463090 12:94820129-94820151 ATGGTTGGGTGGCCTGATGAGGG - Intergenic
1101615338 12:106330747-106330769 ATGGAAAGAAGGCAAGAAGAAGG - Intronic
1101755611 12:107618613-107618635 ATGGAAAGATGGTCTGAGGATGG - Intronic
1102041329 12:109802807-109802829 ATGGATAGATGGATGGATGAAGG - Intronic
1103718701 12:122961930-122961952 AGAGATAGAAGGCCTGACGTGGG - Intronic
1104034688 12:125090140-125090162 ATGGATAGATGGATGGATGATGG - Intronic
1104553487 12:129779156-129779178 AAGGATACAAGGCCTTAGGAAGG + Intronic
1109141297 13:58716036-58716058 ATGGATAGGACTCCTCATGAAGG - Intergenic
1112355443 13:98671202-98671224 TTGGATTGAAGACTTGATGAAGG + Intergenic
1112383923 13:98920041-98920063 ATGGATGGATGGACAGATGATGG + Intronic
1113901007 13:113798081-113798103 ATGGATAGAAGGATGGATAATGG + Intronic
1113901024 13:113798166-113798188 ATGGATAGAAGGATGGATGATGG + Intronic
1113901038 13:113798236-113798258 ATGGATAGAAGGATGGATGATGG + Intronic
1113901092 13:113798543-113798565 ATGGATAGAAGGATGGATGATGG + Intronic
1115153191 14:30309079-30309101 ATGGAAGGAAGCCCTGATGCTGG - Intergenic
1115476571 14:33820298-33820320 ATGTACAGAAGGCCTGAGGAAGG + Intergenic
1116581974 14:46653480-46653502 ATGTATAAAAGGCCTGAAGCAGG + Intergenic
1118373660 14:65158475-65158497 CTGGATGGAAGCCCTGATGAGGG + Intergenic
1119078976 14:71674344-71674366 ATGGATAAGAGGCCTGATCCTGG + Intronic
1119151531 14:72364461-72364483 ATGGCTAGAAAGTCTGATGGAGG - Intronic
1120213079 14:81653460-81653482 TTGGATAGAAGCTATGATGATGG + Intergenic
1121450663 14:94005072-94005094 ATGGAAAGAAGAGCTGATGGGGG - Intergenic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1122831624 14:104400309-104400331 ATGGGTGGAGTGCCTGATGAGGG - Intergenic
1124141321 15:27079661-27079683 ATGAATAGAAGGCCCGAGGCTGG - Intronic
1126970539 15:54106674-54106696 AAGGATAGAATGACTGAGGAAGG - Intronic
1126982877 15:54266256-54266278 TTGCATATATGGCCTGATGAAGG + Intronic
1129502194 15:76050163-76050185 AAGGTTAGAAGACCTAATGATGG + Intronic
1130353648 15:83111488-83111510 ATGGATAGATGGATGGATGATGG - Intronic
1130829456 15:87584560-87584582 ATGAATATAAGACCTGATAAAGG - Intergenic
1130924446 15:88374754-88374776 AAGGAAGGAGGGCCTGATGAGGG + Intergenic
1131385518 15:92003553-92003575 AATGACAGAAGGTCTGATGAAGG - Intronic
1132455553 16:20010-20032 ATGCAGAGAAGTCCTGATGGAGG - Intergenic
1134632282 16:15765453-15765475 ATGGATGGATGGACAGATGATGG + Intronic
1134776090 16:16854968-16854990 ATGGATATATTGCCTGATGCTGG + Intergenic
1136071358 16:27789417-27789439 ATGGATAGATGGAGGGATGATGG + Exonic
1136566384 16:31073225-31073247 ATGGACGGAAGGCCGAATGAGGG + Intronic
1137709937 16:50559627-50559649 AAGGAGACAAGGCCTCATGACGG - Intronic
1138500826 16:57442941-57442963 CTAGATAAAAGGCATGATGAGGG - Intronic
1138814711 16:60191104-60191126 ATGGACAGAAGGCTTTAAGAAGG + Intergenic
1139313863 16:66050919-66050941 AAGGGTAGAAGCCCTGATGATGG + Intergenic
1140266230 16:73423518-73423540 ATGGAAGGAAAGCCTGCTGAAGG + Intergenic
1140929691 16:79615793-79615815 ATGGATGGATGGCTAGATGATGG - Intergenic
1142960519 17:3549656-3549678 ATGGATGGATGGACAGATGATGG + Intronic
1144674479 17:17153123-17153145 ATGGATATGAGAACTGATGAAGG + Intronic
1144810174 17:17993917-17993939 AGGGCCAGAAGGCCTGCTGAGGG + Intronic
1148865103 17:50624237-50624259 AAGGGTAGAGGCCCTGATGAGGG + Intronic
1149540903 17:57467478-57467500 ATAGACAGAAGGGCAGATGAAGG + Intronic
1152763363 17:82121497-82121519 ATGGACAGCAGGTCTGCTGAGGG + Intronic
1153774630 18:8441716-8441738 ATGGGAAGAAGGGCTGATGAAGG + Intergenic
1153882538 18:9433952-9433974 ATGGAAAGAAGGTGTGATGAAGG - Intergenic
1156471629 18:37380693-37380715 ATGGATAGAAGACTAGATGATGG - Intronic
1156471648 18:37380819-37380841 AAGGATAGAAGGATAGATGATGG - Intronic
1156513032 18:37657328-37657350 AAGGACAGAATGCCTGGTGAGGG + Intergenic
1160015849 18:75139812-75139834 AGGGAGTGAAGGCCTGAGGAAGG - Intergenic
1160681774 19:414971-414993 ATGGATAGATGGAATAATGATGG + Intergenic
1161361534 19:3852648-3852670 ATGGATATAAGGGTGGATGAAGG + Intronic
1162774541 19:12971209-12971231 ATGATAAGATGGCCTGATGATGG - Intronic
1162910397 19:13844743-13844765 CTGGATGGAAGGCCTTATTATGG - Intergenic
1163050793 19:14682252-14682274 ATGGATGGATGGATTGATGATGG - Intronic
925101567 2:1251025-1251047 ATGGAAAGAAGCCCTGCTGATGG - Intronic
925219736 2:2128824-2128846 TTGGCTAGAAGGGATGATGAAGG - Intronic
926289175 2:11515142-11515164 ATGGATAGATGGACGGATGGGGG - Intergenic
926758514 2:16254942-16254964 ATGGAGTGAAGGCTTGAGGAAGG + Intergenic
927017553 2:18980889-18980911 CTGGAAAGAAGCCCTGTTGAGGG - Intergenic
927855593 2:26525707-26525729 ATGGATGGAAGGAAGGATGATGG + Intronic
928012283 2:27621059-27621081 ATGGAAAAAAGGCATGATTAGGG - Intronic
929488475 2:42375691-42375713 ATGGACTGTAGGGCTGATGAGGG + Intronic
929925176 2:46201703-46201725 AAGGAGGGAAGGCTTGATGAGGG - Intergenic
930600086 2:53432678-53432700 ATGCATAGAAAGCATGATGCTGG - Intergenic
934129664 2:88935912-88935934 ATGGATTGAAAGACTTATGACGG + Intergenic
937375923 2:121335574-121335596 AAGGGTGCAAGGCCTGATGAGGG + Intergenic
937794053 2:125996356-125996378 ATAGATAGAGGGCTGGATGAGGG - Intergenic
940969176 2:159876513-159876535 GTGGATAGAAGGACTGAACAGGG - Intronic
942728729 2:179040088-179040110 ATGGCTAGAGGTCCAGATGAAGG + Intronic
945829419 2:214764948-214764970 AAGGATAGTAGGGCAGATGAAGG - Intronic
946631833 2:221677741-221677763 ATGTATAGAGGGCCTACTGAAGG + Intergenic
1170910716 20:20564758-20564780 ATGGATGGCAGGCCTGATACTGG - Intronic
1174747026 20:53073245-53073267 ATGGATGGAAGGATAGATGAAGG - Intronic
1175526618 20:59638826-59638848 ATGGATGGATGGGTTGATGATGG + Intronic
1175799005 20:61790401-61790423 ATGGATAGATGGGTAGATGAGGG - Intronic
1175825495 20:61934401-61934423 TTGGAAAGAGGGCCTGCTGAGGG - Intronic
1176066274 20:63197784-63197806 CTTGATAGATGGCCAGATGAGGG - Intronic
1176710101 21:10144120-10144142 ATTCATAGAATGCTTGATGAAGG + Intergenic
1177364472 21:20116758-20116780 ATGGCTGGAAGACCTGAAGATGG - Intergenic
1180107726 21:45630798-45630820 AGGTAAAGAAGGTCTGATGACGG - Intergenic
1180761908 22:18216998-18217020 ATGGTTAGAAGGCCTGTTACTGG - Intergenic
1180773759 22:18407612-18407634 ATGGTTAGAAGGCCTGTTACTGG + Intergenic
1180805110 22:18657156-18657178 ATGGTTAGAAGGCCTGTTACTGG + Intergenic
1180805635 22:18712252-18712274 ATGGTTAGAAGGCCTGTTACTGG - Intergenic
1181069818 22:20326327-20326349 ATGGTTAGAAGGCCTGTTACTGG + Intergenic
1181192860 22:21154537-21154559 ATGGTTAGAAGGCCTGTTACTGG + Intergenic
1181216582 22:21338037-21338059 ATGGTTAGAAGGCCTGTTACTGG - Intergenic
1182086638 22:27565500-27565522 ATGGATAGATGGATGGATGATGG + Intergenic
1182284078 22:29233741-29233763 ATGGATACAAGGGTGGATGATGG - Intronic
1183106550 22:35619033-35619055 ATGGATAGAAGGATAGATGGAGG - Intronic
1185168072 22:49274591-49274613 CTGGATAGAAAGCCTGCTGATGG - Intergenic
1185402752 22:50627195-50627217 ATCGATGGAAGCCCTGATGGGGG + Exonic
1203235591 22_KI270731v1_random:148586-148608 ATGGTTAGAAGGCCTGTTACTGG + Intergenic
949399616 3:3652178-3652200 ATGGGTAAAAGCCCTGATGTAGG - Intergenic
950541233 3:13614567-13614589 ATGGATGGATGGACAGATGATGG - Intronic
952227774 3:31396509-31396531 ATGGACAGAAGGAGTGATGGGGG - Intergenic
953265184 3:41380429-41380451 ATGGTAAGAAGGCCTGTAGATGG - Intronic
954240074 3:49286770-49286792 ATGGATAGATGGATGGATGATGG - Intronic
954318040 3:49811920-49811942 GTGCACAGAAGGCCTGATGCAGG + Exonic
954677283 3:52322932-52322954 ATGGATGGAAGGATGGATGAGGG - Intronic
955342140 3:58133084-58133106 ATGGATGGATGGACTGATGGAGG - Intronic
955342152 3:58133144-58133166 ATGGGTAGACGGACTGATGGAGG - Intronic
958933622 3:100233962-100233984 ATGAATAGAAGGGCTGAAGACGG + Intergenic
959208018 3:103337742-103337764 ATCTATAGAAGGACTGAGGAGGG + Intergenic
959463803 3:106659999-106660021 ATGGAAAGAAGGCATGAGTATGG + Intergenic
959575143 3:107925876-107925898 ATGGATAGGAGGTAGGATGAGGG - Intergenic
960365640 3:116768583-116768605 ATGTATAGAAGGCTGGATGAGGG + Intronic
961041671 3:123682648-123682670 AGGGAGACAAGGCCTGATGGAGG - Intronic
961517195 3:127445270-127445292 ATGTACAAAAGGCCTGAGGATGG + Intergenic
961676998 3:128573723-128573745 ATGGATATTAGCACTGATGAAGG - Exonic
962952268 3:140230126-140230148 ATGGATAGAAGGGGTCCTGATGG + Intronic
965440579 3:168708288-168708310 ACGGATAGAATGCCTGCTAATGG - Intergenic
965949626 3:174291784-174291806 ATGGATATAAGGACTGATAATGG + Intergenic
966862223 3:184236854-184236876 GTGGGGAGAAGGCCTGGTGAGGG - Intronic
968160225 3:196420689-196420711 ATGGAGAGAAGGACAGATAAAGG - Intronic
969091242 4:4695542-4695564 ATGGATGGAAGGATGGATGAGGG - Intergenic
969226264 4:5800520-5800542 AAGGATGGAGGGCCTGGTGAAGG + Intronic
969512297 4:7625684-7625706 ATGGATGGAAGGACGGATGGAGG + Intronic
969520595 4:7675741-7675763 ATGGATGGACGGCCTGATGTGGG + Intronic
969612229 4:8233813-8233835 ATGGATGGATGGACGGATGATGG - Intronic
970139236 4:12962445-12962467 ATGGAGAGATGGCAGGATGAAGG - Intergenic
970295697 4:14627079-14627101 CTGGATGGTAGGTCTGATGAAGG - Intergenic
975527765 4:75369777-75369799 ATGAAATGAAGGCCTGCTGAGGG - Intergenic
975942886 4:79668718-79668740 ATGGTTGCAAGGCCTGAAGATGG + Intergenic
977957580 4:103047944-103047966 TGGTATAGAAGGCCTAATGAGGG + Intronic
978647253 4:110950551-110950573 TTGGAAAGAAGGCATGATGGAGG + Intergenic
979902718 4:126243482-126243504 GGGGATTGAAGGCGTGATGAGGG - Intergenic
981636474 4:146886565-146886587 GAGGAGAGAAGGCCTGATAAAGG + Intronic
988983662 5:36596403-36596425 AAGGAAAGGAGGCCTGCTGAGGG - Intergenic
992359852 5:76026026-76026048 ATGGATAGGATGCCTTATAAAGG - Intergenic
995755879 5:115503343-115503365 ATGGAGAGAAGGGCTGGTAATGG + Intergenic
997458234 5:134033540-134033562 ATGGATAGAAGTCATGCTGGGGG + Intergenic
998046549 5:138991552-138991574 CTGGATAGAAGGCCTGCTGGGGG - Intronic
1000394708 5:160761337-160761359 ATGGCTGGAAGACCTGAAGATGG + Intronic
1003146955 6:3517092-3517114 ATGGAGAGTGGGGCTGATGATGG - Intergenic
1003147011 6:3517260-3517282 ATGGAGAGTGGGGCTGATGATGG - Intergenic
1003304088 6:4910757-4910779 TTGGATAGAAGGCATGAAGTGGG + Intronic
1003810953 6:9780082-9780104 ATGGATGGAAGGCCTGAAGGGGG - Intronic
1003810984 6:9780357-9780379 ATGGATGGAAGGCCTGAAGGGGG + Intronic
1005909340 6:30294472-30294494 TTGGACAGAAGTCATGATGATGG + Intergenic
1005989649 6:30895052-30895074 ATAGATAGAAAGACAGATGATGG - Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007874251 6:45077956-45077978 ATGGATAGAAGGACTGGTTGGGG + Intronic
1009400735 6:63252997-63253019 AGGGCTAGAAGGCGTGATGGGGG - Intergenic
1010572543 6:77495240-77495262 AAGGATCAAAGGCCTGAAGAAGG + Intergenic
1017213451 6:151881969-151881991 AGGGAGGGAAGGGCTGATGATGG + Intronic
1018677689 6:166236969-166236991 AGGGATGGAGGGCCTCATGAGGG - Intergenic
1019326979 7:443331-443353 ATGGATAGATGGATTGATGGAGG + Intergenic
1019914734 7:4125396-4125418 ATGGATAGATGGATGGATGATGG + Intronic
1020639610 7:10739191-10739213 TTGGAAAGGAGGCCAGATGAAGG + Intergenic
1023741728 7:43287269-43287291 CTGGAATGGAGGCCTGATGAAGG + Intronic
1024531060 7:50393136-50393158 ATGGAAAGAAGGGCTTGTGAAGG + Intronic
1025095081 7:56090415-56090437 ATGGATAGAATACATGAGGAAGG - Intronic
1026275397 7:68871784-68871806 ATGGATAGATAGACGGATGATGG - Intergenic
1032520872 7:132544010-132544032 ATGGAAAGAAAACCAGATGAAGG + Intronic
1036778050 8:11627159-11627181 ATGGATGGAAGGATGGATGATGG + Intergenic
1038061004 8:23912643-23912665 ATCGATAGAAGGCCTTTTAAAGG + Intergenic
1038095789 8:24308351-24308373 ATGGATGGAAGGAAAGATGAAGG - Intronic
1038861995 8:31397699-31397721 ATGGTTAGATGGGCTCATGATGG - Intergenic
1044631237 8:94280580-94280602 ATGAATGGAAGGCCTGCTGCTGG + Intergenic
1045769708 8:105721706-105721728 ATGGATAGAAGGCCTGATGAAGG - Intronic
1045833326 8:106490712-106490734 ATGGTGAGAAGGACTGAAGATGG + Intronic
1046087774 8:109460410-109460432 ATGGATAGATGGAATGATGGGGG + Intronic
1048460055 8:134614131-134614153 ATGGGAAGGAAGCCTGATGAAGG - Intronic
1048571818 8:135663112-135663134 ATTAATAGAAGGCATGATAAAGG - Intergenic
1049576539 8:143392389-143392411 ATGGATAGATGGTTGGATGATGG - Intergenic
1052162535 9:25283831-25283853 ATGGCTAGAAAGCCTGAAGTAGG + Intergenic
1052253679 9:26428107-26428129 ATGGCTACAAGACCTGAAGATGG + Intergenic
1053146298 9:35714423-35714445 TTGGGTACAAGGACTGATGATGG + Intronic
1053234994 9:36445464-36445486 TTGTGTAGAAGGTCTGATGAAGG - Intronic
1053305610 9:36982451-36982473 AAGGAGAGAAGGCCTGGAGATGG + Intronic
1053460178 9:38262646-38262668 AGGAATGGAAGCCCTGATGAGGG - Intergenic
1053647082 9:40129816-40129838 ATTCATAGAATGCTTGATGAAGG + Intergenic
1053758642 9:41334025-41334047 ATTCATAGAATGCTTGATGAAGG - Intergenic
1054328083 9:63727775-63727797 ATTCATAGAATGCTTGATGAAGG + Intergenic
1054537497 9:66246352-66246374 ATTCATAGAATGCTTGATGAAGG - Intergenic
1055751288 9:79508399-79508421 TTGTACAGAAGGCCTGGTGAGGG - Intergenic
1058280166 9:103103811-103103833 ATGGAGAGAAGACCTGAGGTAGG - Intergenic
1059310377 9:113384781-113384803 CTGGAAAGAGGACCTGATGATGG + Intergenic
1059416513 9:114165934-114165956 ATGGATAGATGGATGGATGATGG - Intronic
1060368636 9:123046378-123046400 AAGCTTAAAAGGCCTGATGAAGG + Intronic
1061315134 9:129790707-129790729 ATGGAAAGAAGGCCTGGGAAAGG - Intergenic
1061417575 9:130455474-130455496 ATGGACAGAAGGATGGATGATGG - Intronic
1061724019 9:132571594-132571616 ATGGATAGAAGCCCAGATGCAGG + Intronic
1062520776 9:136957032-136957054 ATGGATAGATGGTTGGATGATGG + Intronic
1202794864 9_KI270719v1_random:113115-113137 ATTCATAGAATGCTTGATGAAGG + Intergenic
1187433563 X:19246854-19246876 ATGGAGAGGTGGTCTGATGATGG - Intergenic
1187866676 X:23729030-23729052 ATGAATTGAAAGTCTGATGAAGG + Intronic
1188719082 X:33500616-33500638 ATGGCTTGGAGGCCTGAGGATGG + Intergenic
1189258408 X:39658654-39658676 ATGGGTAGAAGTCCTGCTCAGGG + Intergenic
1189265564 X:39713424-39713446 ATGGATGGATGGTCAGATGATGG + Intergenic
1196037009 X:111156382-111156404 ATGGATTGACTGCTTGATGAAGG + Intronic
1196310900 X:114163880-114163902 ATGGATAAAAGGCAAGATGAAGG - Intergenic
1198559851 X:137837865-137837887 ATGGCTACAAGACCTGAAGATGG - Intergenic
1200400820 X:156019719-156019741 ATGCAGAGAAGTCCTGATGGAGG + Intergenic