ID: 1045777750

View in Genome Browser
Species Human (GRCh38)
Location 8:105825732-105825754
Sequence AGGCAATGAGGAGCCACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045777750_1045777755 16 Left 1045777750 8:105825732-105825754 CCTCCAGTGGCTCCTCATTGCCT No data
Right 1045777755 8:105825771-105825793 ATTCCTTAACATGATTAACAAGG No data
1045777750_1045777757 30 Left 1045777750 8:105825732-105825754 CCTCCAGTGGCTCCTCATTGCCT No data
Right 1045777757 8:105825785-105825807 TTAACAAGGCCTTAAGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045777750 Original CRISPR AGGCAATGAGGAGCCACTGG AGG (reversed) Intergenic