ID: 1045777751

View in Genome Browser
Species Human (GRCh38)
Location 8:105825735-105825757
Sequence TGAAGGCAATGAGGAGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045777751_1045777758 28 Left 1045777751 8:105825735-105825757 CCAGTGGCTCCTCATTGCCTTCA No data
Right 1045777758 8:105825786-105825808 TAACAAGGCCTTAAGTCACTGGG No data
1045777751_1045777757 27 Left 1045777751 8:105825735-105825757 CCAGTGGCTCCTCATTGCCTTCA No data
Right 1045777757 8:105825785-105825807 TTAACAAGGCCTTAAGTCACTGG No data
1045777751_1045777755 13 Left 1045777751 8:105825735-105825757 CCAGTGGCTCCTCATTGCCTTCA No data
Right 1045777755 8:105825771-105825793 ATTCCTTAACATGATTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045777751 Original CRISPR TGAAGGCAATGAGGAGCCAC TGG (reversed) Intergenic