ID: 1045777754

View in Genome Browser
Species Human (GRCh38)
Location 8:105825752-105825774
Sequence GAATTTGTACTTGATCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045777754_1045777755 -4 Left 1045777754 8:105825752-105825774 CCTTCAGGATCAAGTACAAATTC No data
Right 1045777755 8:105825771-105825793 ATTCCTTAACATGATTAACAAGG No data
1045777754_1045777757 10 Left 1045777754 8:105825752-105825774 CCTTCAGGATCAAGTACAAATTC No data
Right 1045777757 8:105825785-105825807 TTAACAAGGCCTTAAGTCACTGG No data
1045777754_1045777758 11 Left 1045777754 8:105825752-105825774 CCTTCAGGATCAAGTACAAATTC No data
Right 1045777758 8:105825786-105825808 TAACAAGGCCTTAAGTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045777754 Original CRISPR GAATTTGTACTTGATCCTGA AGG (reversed) Intergenic