ID: 1045777758

View in Genome Browser
Species Human (GRCh38)
Location 8:105825786-105825808
Sequence TAACAAGGCCTTAAGTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045777751_1045777758 28 Left 1045777751 8:105825735-105825757 CCAGTGGCTCCTCATTGCCTTCA No data
Right 1045777758 8:105825786-105825808 TAACAAGGCCTTAAGTCACTGGG No data
1045777753_1045777758 19 Left 1045777753 8:105825744-105825766 CCTCATTGCCTTCAGGATCAAGT No data
Right 1045777758 8:105825786-105825808 TAACAAGGCCTTAAGTCACTGGG No data
1045777754_1045777758 11 Left 1045777754 8:105825752-105825774 CCTTCAGGATCAAGTACAAATTC No data
Right 1045777758 8:105825786-105825808 TAACAAGGCCTTAAGTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045777758 Original CRISPR TAACAAGGCCTTAAGTCACT GGG Intergenic