ID: 1045784618

View in Genome Browser
Species Human (GRCh38)
Location 8:105905621-105905643
Sequence AAACAGAAGCAAAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1045784613_1045784618 11 Left 1045784613 8:105905587-105905609 CCTTGGAAAAGGCTTCTGAACTC No data
Right 1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1045784618 Original CRISPR AAACAGAAGCAAAATGAGGA AGG Intergenic
No off target data available for this crispr